Transcript asmbl_151416

Sequence
Transcript Sequence for observation asmbl_151416 of TGE0058556:
CCCACCATCACGCCCTGGGAAGGAAAGGACAAGAAGCCCTGAGCACGGGCGCAGCCCCCACCCCGGAAACCGGGAGGCTCCTGTGCAGAGAAAGCGCCCTTGCCTCCCGCCCGCTCCCGGGGCTGCCCCACCCAGCCAGCTCCCCTACCTGGTGCCTGGGGCGCCCCACGATGGAGGGGAAGACGGCCCGGGGGGCATCGTCGCCCGCGAAGCCGGCCTTGCACATGCCGGAGCCGTTGTCGACGACGAGCGCGGCGATATCATCATCCATGGTGAG