Transcript asmbl_150530

Sequence
Transcript Sequence for observation asmbl_150530 of TGE0058555:
CGTTGCTATTTATGCTCTCTTTCCTGTCACTTTCAGGGTGTTCAAGGTGGAAAAGGTGAACAGGGTCCCCCTGGTCCTCCAGGCTTCCAGGGTCTGCCTGGCCCCTCAGGTCCCGCTGGTGAAGTTGGCAAACCAGGAGAAAGGGGTCTCCATGGTGAGTTTGGTCTCCCTGGTCCTGCTGGTCCAAGAGGGGAACGCGGTCCCCCAGGTGAGAGTGGTGCTGCCGGTCCTACTGGTCCTATTGGAAGCCGAGGTCCTTCTGGACCCCCAGGGCCTGATGGAAACAAGGGTGAACCTGGTGTGGTTGGTGCTGTGGGCACTGCTGGTCCATCTGGTCCTAGTGGACTCCCAGGAGAGAGGGGTGCTGCTGGCATACCTGGAGGCAAGGGAGAAAAGGGTGAACCTGGTCTCAGAGGTGAAATTGGTAACCCTGGCAGAGATGGTGCTCGTGGTGCTCCTGGTGCTGTAGGTGCCCCTGGTCCTGCTGGAGCCACAGGTGACCGGGGCGAAGCTGGGGCTGCTGGTCCTGCTGGTCCTGCTGGTCCTCGGGGAAGCCCTGGTGAACGTGGTGAGGTCGGTCCTGCTGGCCCCAATGGATTTGCTGGTCCTGCTGGTGCTGCTGGTCAACCTGGTGCTAAAGGAGAAAGAGGAGCCAAAGGGCCTAAGGGTGAAAACGGTGTTGTTGGTCCCACAGGCCCCGTTGGAGCTGCTGGCCCAGCTGGTCCAAATGGTCCCCCCGGTCCTGCTGGAAGTCGTGGTGATGGAGGCCCCCCTGGTATGACTGGTTTCCCTGGTGCTGCTGGACGGACTGGTCCCCCAGGACCCTCTGGTATTTCTGGCCCTCCTGGTCCCCCTGGTCCTGCTGGGAAAGAAGGGCTTCGTGGTCCTCGTGGTGACCAAGGTCCAGTTGGCCGAACTGGAGAAGTAGGTGCAGTTGGTCCCCCTGGCTTCGCTGGTGAGAAGGGTCCCTCTGGAGAGGCTGGTACTGCTGGACCTCCTGGCACTCCAGGTCCTCAGGGTCTTCTTGGTGCTCCTGGTATTCTGGGTCTCCCTGGCTCGAGAGGTGAACGTGGTCTACCAGGTGTTGCTGGTGCTGTGGGTGAACCTGGTCCTCTTGGCATTGCCGGCCCTCCTGGGGCCCGTGGTCCTCCTGGTGCTGTGGGTAGTCCTGGAGTCAACGGTGCTCCTGGTGAAGCTGGTCGTGATGGCAACCCTGGGAACGATGGTCCCCCAGGTCGCGATGGTCAACCCGGACACAAGGGAGAGCGCGGTTACCCTGGCAATATTGGTCCCGTTGGTGCTGCAGGTGCACCTGGTCCTCATGGCCCCGTGGGTCCTGCTGGCAAACATGGAAACCGTGGTGAAACTGGTCCTTCTGGTCCTGTTGGTCCTGCTGGTGCTGTTGGCCCAAGAGGTCCTAGTGGCCCACAAGGCATTCGTGGCGATAAGGGAGAGCCCGGTGAAAAGGGGCCCAGAGGTCTTCCTGGCTTAAAGGGACACAATGGATTGCAAGGTCTGCCTGGTATCGCTGGTCACCATGGTGATCAAGGTGCTCCTGGCTCCGTGGGTCCTGCTGGTCCTAGGGGCCCTGCTGGTCCTTCTGGCCCTGCTGGAAAAGATGGTCGCACTGGACATCCTGGTACAGTTGGACCTGCTGGCATTCGAGGCCCTCAGGGTCACCAAGGCCCTGCTGGCCCCCCTGGTCCCCCTGGCCCTCCTGGACCTCCAGGTGTAAGCGGTGGTGGTTATGACTTTGGTTACGATGGAGACTTCTACAGGGCTGACCAGCCTCGCTCAGCACCTTCTCTCAGACCCAAGGACTATGAAGTTGATGCTACTCTGAAGTCTCTCAACAACCAGATTGAGACCCTTCTTACTCCTGAAGGCTCTAGAAAGAACCCAGCTCGCACATGCCGTGACTTGAGACTCAGCCACCCAGAGTGGAGCAGTGGTTACTACTGGATTGACCCTAACCAAGGATGCACTATGGATGCTATCAAAGTATACTGTGATTTCTCTACTGGCGAAACCTGTATCCGGGCCCAACCTGAAAACATCCCAGCCAAGAACTGGTATAGGAGCTCCAAGGACAAGAAACACGTCTGGCTAGGAGAAACTATCAATGCTGGCAGCCAGTTTGAATATAATGTAGAAGGAGTGACTTCCAAGGAAATGGCTACCCAACTTGCCTTCATGCGCCTGCTGGCCAACTATGCCTCTCAGAACATCACCTACCACTGCAAGAACAGCATTGCATACATGGATGAGGAGACTGGCAACCTGAAAAAGGCTGTCATTCTACAGGGCTCTAATGATGTTGAACTTGTTGCTGAGGGCAACAGCAGGTTCACTTACACTGTTCTTGTAGATGGCTGCTCTAAAAAGACAAATGAATGGGGAAAGACAATCATTGAATACAAAACAAATAAGCCATCACGCCTGCCCTTCCTTGATATTGCACCTTTGGACATCGGTGGTGCTGACCAGGAATTCTTTGTGGACATTGGCCCAGTCTGTTTCAAATAAATGAACTCAATCTAAATTAAAAAAGAAAGAAATTTGAAAAAACTTTCTCTTTGCCATTTCTTCTTCTTCTTTTTTAACTGAAAGCTGAATCCTTCCATTTCTTCTGCACATCTACTTGCTTAAATTGTGGGCAAAAGAGAAAAAGAAGGATTGATCAGAGCATTGTGCAATACAGTTTCATTAACTCCTTCCCCCGCTCCCCCAAAAATTTGAATTTTTTTTTCAACACTCTTACACCTGTTATGGAAAATGTCAACCTTTGTAAGAAAACCAAAATAAAAATTGAAAAATAAAAACCATAAACATTTGCACCACTTGTGGCTTTTGAATATCTTCCACAGAGGGAAGTTTAAAACCCAAACTTCCAAAGGTTTAAACTACCTCAAAACACTTTCCCATGAGTGTGATCCACATTGTTAGGTGCTGACCTAGACAGAGATGAACTGAGGTCCTTGTTTTGTTTTGTTCATAATACAAAGGTGCTAATTAATAGTATTTCAGATACTTGAAGAATGTTGATGGTGCTAGAAGAATTTGAGAAGAAATACTCCTGTATTGAGTTGTATCGTGTGGTGTATTTTTTAAAAAATTTGATTTAGCATTCATATTTTCCATCTTATTCCCAATTAAAAGTATGCAGATTATTTGCCCAAATCTTCTTCAGATTCAGCATTTGTTCTTTGCCAGTCTCATTTTCATCTTCTTCCATGGTTCCACAGAAGCTTTGTTTCTTGGGCAAGCAGAAAAATTAAATTGTACCTATTTTGTATATGTGAGATGTTTAAATAAATTGTGAAAAAAATGAAATAAAGCATG