Transcript asmbl_150529

Sequence
Transcript Sequence for observation asmbl_150529 of TGE0056417:
CCTTGAAAGCCTCAAAAGTGTCCACGTCCTCAAAAAGAATGGAACCAATTTAAGAAGCCAGCCCCGTGGCCACGTCCCTTCCCCCATTCGCTCCCTCCTCTGCGCCCCCGCAGGCTCCTCCCAGCTGTGGCTGCCCGGGCCCCCAGCCCCAGCCCTCCCATTGGTGGAGGCCCTTTTGGAGGCACCCTAGGGCCAGGGAAACTTTTGCCGTATAAATAGGGCAGATCCGGGCTTTATTATTTTAGCACCACGGCAGCAGGAGGTTTCGGCTAAGTTGGAGGTACTGGCCACGACTGCATGCCCGCGCCCGCCAGGTGATACCTCCGCCGGTGACCCAGGGGCTCTGCGACACAAGGAGTCTGCATGTCTAAGTGCTAGACATGCTCAGCTTTGTGGATACGCGGACTTTGTTGCTGCTTGCAGTAACCTTATGCCTAGCAACATGCCAATCTTTACAAGAGGAAACTGTAAGAAAGGGCCCAGCCGGAGATAGAGGACCACGTGGAGAAAGGGGTCCACCAGGCCCCCCAGGCAGAGATGGTGAAGATGGTCCCACAGGCCCTCCTGGTCCACCTGGTCCTCCTGGCCCCCCTGGTCTCGGTGGGAACTTTGCTGCTCAGTATGATGGAAAAGGAGTTGGACTTGGCCCTGGACCAATGGGCTTAATGGGACCTAGAGGCCCACCTGGTGCAGCTGGAGCCCCAGGCCCTCAAGGTTTCCAAGGACCTGCTGGTGAGCCTGGTGAACCTGGTCAAACTGGTCCTGCAGGTGCTCGTGGTCCAGCTGGCCCTCCTGGCAAGGCTGGTGAAGATGGTCACCCTGGAAAACCCGGACGACCTGGTGAGAGAGGAGTTGTTGGACCACAGGGTGCTCGTGGTTTCCCTGGAACTCCTGGACTTCCTGGCTTCAAAGGCATTAGGGGACACAATGGTCTGGATGGATTGAAGGGACAGCCCGGTGCTCCTGGTGTGAAGGGTGAACCTGGTGCCCCTGGTGAAAATGGAACTCCAGGTCAAACAGGAGCCCGTGGGCTTCCTGGTGAGAGAGGACGTGTTGGTGCCCCTGGCCCAGCTGGTGCCCGTGGCAGTGATGGAAGTGTGGGTCCCGTGGGTCCTGCTGGTCCCATTGGGTCTGCTGGCCCTCCAGGCTTCCCAGGTGCCCCTGGCCCCAAGGGTGAAATTGGAGCTGTTGGTAACGCTGGTCCTGCTGGTCCCGCCGGTCCCCGTGGTGAAGTGGGTCTTCCAGGCCTCTCCGGCCCCGTTGGACCTCCTGGTAATCCTGGAGCAAACGGCCTTACTGGTGCCAAGGGTGCTGCTGGCCTTCCCGGCGTTGCTGGGGCTCCCGGCCTCCCTGGACCCCGCGGTATTCCTGGCCCTGTTGGTGCTGCCGGTGCTACTGGTGCCAGAGGACTTGTTGGTGAGCCTGGTCCAGCTGGCTCCAAAGGAGAGAGCGGTAACAAGGGTGAGCCCGGCTCTGCTGGGCCCCAAGGTCCTCCTGGTCCCAGTGGTGAAGAAGGAAAGAGAGGCCCTAATGGGGAAGCTGGATCTGCCGGCCCTCCAGGACCTCCTGGGCTGAGAGGTAGTCCTGGTTCTCGTGGTCTTCCTGGAGCTGATGGCAGAGCTGGCGTCATGGGCCCTCCTGGTAGTCGTGGTGCAAGTGGCCCTGCTGGAGTCCGAGGACCTAATGGAGATGCTGGTCGCCCTGGGGAGCCTGGTCTCATGGGACCCAGAGGTCTTCCTGGTTCCCCTGGAAATATCGGCCCCGCTGGAAAAGAAGGTCCTGTCGGCCTCCCTGGCATCGACGGCAGGCCTGGCCCAATTGGCCCAGCTGGAGCAAGAGGAGAGCCTGGCAACATTGGATTCCCTGGACCCAAAGGCCCCACTGGTGATCCTGGCAAAAACGGTGATAAAGGTCATGCTGGTCTTGCTGGTGCTCGGGGTGCTCCAGGTCCTGATGGAAACAATGGTGCTCAGGGACCTCCTGGACCACAGGGTGTTCAAGGTGGAAAAGGTGAACAGGGTCCCCCTGGTCCTCCAGGCTTCCAGGGTCTGCCTGGCCCCTCAGGTCCCGCTGGTGAAGTTGGCAAACCAGGAGAAAGGGGTCTCCATGGTGAGTTTGGTCTCCCTGGTCCTGCTGGTCCAAGAGGGGAACGCGGTCCCCCAGGTGAGAGTGGTGCTGCCGGTCCTACTGGTCCTATTGGAAGCCGAGGTCCTTCTGGACCCCCAGGGCCTGATGGAAACAAGGGTGAACCTGGTGTGGTTGGTGCTGTGGGCACTGCTGGTCCATCTGGTCCTAGTGGACTCCCAGGAGAGAGGGGTGCTGCTGGCATACCTGGAGGCAAGGGAGAAAAGGGTGAACCTGGTCTCAGAGGTGAAATTGGTAACCCTGGCAGAGATGGTGCTCGTGGTGCTCCTGGTGCTGTAGGTGCCCCTGGTCCTGCTGGAGCCACAGGTGACCGGGGCGAAGCTGGGGCTGCTGGTCCTGCTGGTCCTGCTGGTCCTCGGGGAAGCCCTGGTGAACGTGGTGAGGTCGGTCCTGCTGGCCCCAATGGATTTGCTGGTCCTGCTGGTGCTGCTGGTCAACCTGGTGCTAAAGGAGAAAGAGGAGCCAAAGGGCCTAAGGGTGAAAACGGTGTTGTTGGTCCCACAGGCCCCGTTGGAGCTGCTGGCCCAGCTGGTCCAAATGGTCCCCCCGGTCCTGCTGGAAGTCGTGGTGATGGAGGCCCCCCTGGTATGACTGGTTTCCCTGGTGCTGCTGGACGGACTGGTCCCCCAGGACCCTCTGGTATTTCTGGCCCTCCTGGTCCCCCTGGTCCTGCTGGGAAAGAAGGGCTTCGTGGTCCTCGTGGTGACCAAGGTCCAGTTGGCCGAACTGGAGAAGTAGGTGCAGTTGGTCCCCCTGGCTTCGCTGGTGAGAAGGGTCCCTCTGGAGAGGCTGGTACTGCTGGACCTCCTGGCACTCCAGGTCCTCAGGGTCTTCTTGGTGCTCCTGGTATTCTGGGTCTCCCTGGCTCGAGAGGTGAACGTGGTCTACCAGGTGTTGCTGGTGCTGTGGGTGAACCTGGTCCTCTTGGCATTGCCGGCCCTCCTGGGGCCCGTGGTCCTCCTGGTGCTGTGGGTAGTCCTGGAGTCAACGGTGCTCCTGGTGAAGCTGGTCGTGATGGCAACCCTGGGAACGATGGTCCCCCAGGTCGCGATGGTCAACCCGGACACAAGGGAGAGCGCGGTTACCCTGGCAATATTGGTCCCGTTGGTGCTGCAGGTGCACCTGGTCCTCATGGCCCCGTGGGTCCTGCTGGCAAACATGGAAACCGTGGTGAAACTGGTCCTTCTGGTCCTGTTGGTCCTGCTGGTGCTGTTGGCCCAAGAGGTCCTAGTGGCCCACAAGGCATTCGTGGCGATAAGGGAGAGCCCGGTGAAAAGGGGCCCAGAGGTCTTCCTGGCTTAAAGGGACACAATGGATTGCAAGGTCTGCCTGGTATCGCTGGTCACCATGGTGATCAAGGTGCTCCTGGCTCCGTGGGTCCTGCTGGTCCTAGGGGCCCTGCTGGTCCTTCTGGCCCTGCTGGAAAAGATGGTCGCACTGGACATCCTGGTACAGTTGGACCTGCTGGCATTCGAGGCCCTCAGGGTCACCAAGGCCCTGCTGGCCCCCCTGGTCCCCCTGGCCCTCCTGGACCTCCAGGTGTAAGCGGTGGTGGTTATGACTTTGGTTACGATGGAGACTTCTACAGGGCTGACCAGCCTCGCTCAGCACCTTCTCTCAGACCCAAGGACTATGAAGTTGATGCTACTCTGAAGTCTCTCAACAACCAGATTGAGACCCTTCTTACTCCTGAAGGCTCTAGAAAGAACCCAGCTCGCACATGCCGTGACTTGAGACTCAGCCACCCAGAGTGGAGCAGTGGTTACTACTGGATTGACCCTAACCAAGGATGCACTATGGATGCTATCAAAGTATACTGTGATTTCTCTACTGGCGAAACCTGTATCCGGGCCCAACCTGAAAACATCCCAGCCAAGAACTGGTATAGGAGCTCCAAGGACAAGAAACACGTCTGGCTAGGAGAAACTATCAATGCTGGCAGCCAGTTTGAATATAATGTAGAAGGAGTGACTTCCAAGGAAATGGCTACCCAACTTGCCTTCATGCGCCTGCTGGCCAACTATGCCTCTCAGAACATCACCTACCACTGCAAGAACAGCATTGCATACATGGATGAGGAGACTGGCAACCTGAAAAAGGCTGTCATTCTACAGGGCTCTAATGATGTTGAACTTGTTGCTGAGGGCAACAGCAGGTTCACTTACACTGTTCTTGTAGATGGCTGCTCTAAAAAGACAAATGAATGGGGAAAGACAATCATTGAATACAAAACAAATAAGCCATCACGCCTGCCCTTCCTTGATATTGCACCTTTGGACATCGGTGGTGCTGACCAGGAATTCTTTGTGGACATTGGCCCAGTCTGTTTCAAATAAATGAACTCAATCTAAATTAAAAAAGAAAGAAATTTGAAAAAACTTTCTCTTTGCCATTTCTTCTTCTTCTTTTTTAACTGAAAGCTGAATCCTTCCATTTCTTCTGCACATCTACTTGCTTAAATTGTGGGCAAAAGAGAAAAAGAAGGATTGATCAGAGCATTGTGCAATACAGTTTCATTAACTCCTTCCCCCGCTCCCCCAAAAATTTGAATTTTTTTTTCAACACTCTTACACCTGTTATGGAAAATGTCAACCTTTGTAAGAAAACCAAAATAAAAATTGAAAAATAAAAACCATAAACATTTGCACCACTTGTGGCTTTTGAATATCTTCCACAGAGGGAAGTTTAAAACCCAAACTTCCAAAGGTTTAAACTACCTCAAAACACTTTCCCATGAGTGTGATCCACATTGTTAGGTGCTGACCTAGACAGAGATGAACTGAGGTCCTTGTTTTGTTTTGTTCATAATACAAAGGTGCTAATTAATAGTATTTCAGATACTTGAAGAATGTTGATGGTGCTAGAAGAATTTGAGAAGAAATACTCCTGTATTGAGTTGTATCGTGTGGTGTATTTTTTAAAAAATTTGATTTAGCATTCATATTTTCCATCTTATTCCCAATTAAAAGTATGCAGATTATTTGCCCAAATCTTCTTCAGATTCAGCATTTGTTCTTTGCCAGTCTCATTTTCATCTTCTTCCATGGTTCCACAGAAGCTTTGTTTCTTGGGCAAGCAGAAAAATTAAATTGTACCTATTTTGTATATGTGAGATGTTTAAATAAATTGTGAAAAAAATGAAATAAAGCATGTTTGGTTTTCCAAAAGAA