Transcript asmbl_150528

Sequence
Transcript Sequence for observation asmbl_150528 of TGE0058554:
CCTTGAAAGCCTCAAAAGTGTCCACGTCCTCAAAAAGAATGGAACCAATTTAAGAAGCCAGCCCCGTGGCCACGTCCCTTCCCCCATTCGCTCCCTCCTCTGCGCCCCCGCAGGCTCCTCCCAGCTGTGGCTGCCCGGGCCCCCAGCCCCAGCCCTCCCATTGGTGGAGGCCCTTTTGGAGGCACCCTAGGGCCAGGGAAACTTTTGCCGTATAAATAGGGCAGATCCGGGCTTTATTATTTTAGCACCACGGCAGCAGGAGGTTTCGGCTAAGTTGGAGGTACTGGCCACGACTGCATGCCCGCGCCCGCCAGGTGATACCTCCGCCGGTGACCCAGGGGCTCTGCGACACAAGGAGTCTGCATGTCTAAGTGCTAGACATGCTCAGCTTTGTGGATACGCGGACTTTGTTGCTGCTTGCAGTAACCTTATGCCTAGCAACATGCCAATCTTTACAAGAGGAAACTGTAAGAAAGGGCCCAGCCGGAGATAGAGGACCACGTGGAGAAAGGGGTCCACCAGGCCCCCCAGGCAGAGATGGTGAAGATGGTCCCACAGGCCCTCCTGGTCCACCTGGTCCTCCTGGCCCCCCTGGTCTCGGTGGGAACTTTGCTGCTCAGTATGATGGAAAAGGAGTTGGACTTGGCCCTGGACCAATGGGCTTAATGGGACCTAGAGGCCCACCTGGTGCAGCTGGAGCCCCAGGCCCTCAAGGTTTCCAAGGACCTGCTGGTGAGCCTGGTGAACCTGGTCAAACTGGTCCTGCAGGTGCTCGTGGTCCAGCTGGCCCTCCTGGCAAGGCTGGTGAAGATGGTCACCCTGGAAAACCCGGACGACCTGGTGAGAGAGGAGTTGTTGGACCACAGGGTGCTCGTGGTTTCCCTGGAACTCCTGGACTTCCTGGCTTCAAAGGCATTAGGGGACACAATGGTCTGGATGGATTGAAGGGACAGCCCGGTGCTCCTGGTGTGAAGGGTGAACCTGGTGCCCCTGGTGAAAATGGAACTCCAGGTCAAACAGGAGCCCGTGGGCTTCCTGGTGAGAGAGGACGTGTTGGTGCCCCTGGCCCAGCTGGTGCCCGTGGCAGTGATGGAAGTGTGGGTCCCGTGGGTCCTGCTGGTCCCATTGGGTCTGCTGGCCCTCCAGGCTTCCCAGGTGCCCCTGGCCCCAAGGGTGAAATTGGAGCTGTTGGTAACGCTGGTCCTGCTGGTCCCGCCGGTCCCCGTGGTGAAGTGGGTCTTCCAGGCCTCTCCGGCCCCGTTGGACCTCCTGGTAATCCTGGAGCAAACGGCCTTACTGGTGCCAAGGGTGCTGCTGGCCTTCCCGGCGTTGCTGGGGCTCCCGGCCTCCCTGGACCCCGCGGTATTCCTGGCCCTGTTGGTGCTGCCGGTGCTACTGGTGCCAGAGGACTTGTTGGTGAGCCTGGTCCAGCTGGCTCCAAAGGAGAGAGCGGTAACAAGGGTGAGCCCGGCTCTGCTGGGCCCCAAGGTCCTCCTGGTCCCAGTGGTGAAGAAGGAAAGAGAGGCCCTAATGGGGAAGCTGGATCTGCCGGCCCTCCAGGACCTCCTGGGCTGAGAGGTAGTCCTGGTTCTCGTGGTCTTCCTGGAGCTGATGGCAGAGCTGGCGTCATGGGCCCTCCTGGTAGTCGTGGTGCAAGTGGCCCTGCTGGAGTCCGAGGACCTAATGGAGATGCTGGTCGCCCTGGGGAGCCTGGTCTCATGGGACCCAGAGGTCTTCCTGGTTCCCCTGGAAATATCGGCCCCGCTGGAAAAGAAGGTCCTGTCGGCCTCCCTGGCATCGACGGCAGGCCTGGCCCAATTGGCCCAGCTGGAGCAAGAGGAGAGCCTGGCAACATTGGATTCCCTGGACCCAAAGGCCCCACTGGTGATCCTGGCAAAAACGGTGATAAAGGTCATGCTGGTCTTGCTGGTGCTCGGGGTGCTCCAGGTCCTGATGGAAACAATGGTGCTCAGGGACCTCCTGGACCACAGGGTGTTCAAGGTGGAAAAGGTGAACAGGGTCCCCCTGGTCCTCCAGGCTTCCAGGGTCTGCCTGGCCCCTCAGGTCCCGCTGGTGAAGTTGGCAAACCAGGAGAAAGGGGTCTCCATGGTGAGTTTGGTCTCCCTGGTCCTGCTGGTCCAAGAGGGGAACGCGGTCCCCCAGGTGAGAGTGGTGCTGCCGGTCCTACTGGTCCTATTGGAAGCCGAGGTCCTTCTGGACCCCCAGGGCCTGATGGAAACAAGGGTGAACCTGGTGTGGTTGGTGCTGTGGGCACTGCTGGTCCATCTGGTCCTAGTGGACTCCCAGGAGAGAGGGGTGCTGCTGGCATACCTGGAGGCAAGGGAGAAAAGGGTGAACCTGGTCTCAGAGGTGAAATTGGTAACCCTGGCAGAGATGGTGCTCGTGGTGCTCCTGGTGCTGTAGGTGCCCCTGGTCCTGCTGGAGCCACAGGTGACCGGGGCGAAGCTGGGGCTGCTGGTCCTGCTGGTCCTGCTGGTCCTCGGGGAAGCCCTGGTGAACGTGGTGAGGTCGGTCCTGCTGGCCCCAATGGATTTGCTGGTCCTGCTGGTGCTGCTGGTCAACCTGGTGCTAAAGGAGAAAGAGGAGCCAAAGGGCCTAAGGGTGAAAACGGTGTTGTTGGTCCCACAGGCCCCGTTGGAGCTGCTGGCCCAGCTGGTCCAAATGGTCCCCCCGGTCCTGCTGGAAGTCGTGGTGATGGAGGCCCCCCTGGTATGACTGGTTTCCCTGGTGCTGCTGGACGGACTGGTCCCCCAGGACCCTCTGTAAGTAAATCACTGTAAACGTGTCTTCATTTACTCTAGCC