Transcript asmbl_150457

Sequence
Transcript Sequence for observation asmbl_150457 of TGE0056415:
TTGGACTGTGGACTTTTGAGTTAACGCTGAAATGAGTCTCTCTCTTTGCCTGCCTCCATCCACGTAAGATATGACTTGGTCCTCCTTGCCTTCGGCAATGATTGTGTGGCCTCCCCAGCCACGTAGAACTATAGCTTTCCAATGATTAGACGAATTGATTCTTTCTGTGACTCATCAGTTCATTTCCTGTAAAATTCATGTCTTGCTGTTGATTTGTGAATAAGAACCAGAGCTTGTAGAAACCACTTTAATCATATCCAGGAGTTTGCAAGAAACAGGTGCTTAACACTAATTCACCTCCTGAACAAGAAAAATGGGCTGTGACCGGAACTGTGGGCTCATCGCTGGGGCTGTCATTGGTGCTGTCCTGGCTGTGTTTGGAGGTATTCTAATGCCAGTTGGAGACCTGCTTATCCAGAAGACAATTAAAAAGCAAGTTGTCCTCGAAGAAGGTACAATTGCTTTTAAAAATTGGGTTAAAACAGGCACAGAAGTTTACAGACAGTTTTGGATCTTTGATGTGCAAAATCCACAGGAAGTGATGATGAACAGCAGCAACATTCAAGTTAAGCAAAGAGGTCCTTATACGTACAGAGTTCGTTTTCTAGCCAAGGAAAATGTAACCCAGGACGCTGAGGACAACACAGTCTCTTTCCTGCAGCCCAATGGTGCCATCTTCGAACCTTCACTATCAGTTGGAACAGAGGCTGACAACTTCACAGTTCTCAATCTGGCTGTGGCAGCTGCATCCCATATCTATCAAAATCAATTTGTTCAAATGATCCTCAATTCACTTATTAACAAGTCAAAATCTTCTATGTTCCAAGTCAGAACTTTGAGAGAACTGTTATGGGGCTATAGGGATCCATTTTTGAGTTTGGTTCCGTACCCTGTTACTACCACAGTTGGTCTGTTTTATCCTTACAACAATACTGCAGATGGAGTTTATAAAGTTTTCAATGGAAAAGATAACATAAGTAAAGTTGCCATAATCGACACATATAAAGGTAAAAGGAATCTGTCCTATTGGGAAAGTCACTGCGACATGATTAATGGTACAGATGCAGCCTCATTTCCACCTTTTGTTGAGAAAAGCCAGGTATTGCAGTTCTTTTCTTCTGATATTTGCAGGTCAATCTATGCTGTATTTGAATCCGACGTTAATCTGAAAGGAATCCCTGTGTATAGATTTGTTCTTCCATCCAAGGCCTTTGCCTCTCCAGTTGAAAACCCAGACAACTATTGTTTCTGCACAGAAAAAATTATCTCAAAAAATTGTACATCATATGGTGTGCTAGACATCAGCAAATGCAAAGAAGGGAGACCTGTGTACATTTCACTTCCTCATTTTCTGTATGCAAGTCCTGATGTTTCAGAACCTATTGATGGATTAAACCCAAATGAAGAAGAACATAGGACATACTTGGATATTGAACCTATAACTGGATTCACTTTACAATTTGCAAAACGGCTGCAGGTCAACCTATTGGTCAAGCCATCAGAAAAAATTCAAGTATTAAAGAATCTGAAGAGGAACTATATTGTGCCTATTCTTTGGCTTAATGAGACTGGGACCATTGGTGATGAGAAGGCAAACATGTTCAGAAGTCAAGTAACTGGAAAAATAAACCTCCTTGGCCTGATAGAAATGATCTTACTCAGTGTTGGTGTGGTGATGTTTGTTGCTTTTATGATTTCATATTGTGCATGCAGATCGAAAACAATAAAATAAGTAAGTATGTACCAAAAAATATTGCTTCAATAATATTAGCTTATATATTACTTGTTTTCACTTTATCAAAGAGAAGTTACATATTAGGCCATATATATTTCTAGACATGTCTAGCCACTGATCATTTTTAAATATAGGTAAATAAACCTATAAATATTATCACGCAGATCACTAAAGTATATCTTTAATTCTGGGAGAAATGAGATAAAAGATGTACTTGTGACCATTGTAACAATAGCACAAATAAAGCACTTGTGCCAAAGTTGTCCAAAATTGACTGGTTCATTTCTCAATTATATAGCTAGTTATATATTATCTGATACTTAAAAATAATTGACTAGGAAATGGTTTCATAAGACCAGGATTGCTGCATGTAGACATGCTGGCCGTGCATTTTCCAAATCCAGAAAAGTCCTGAACAAAAATTTGAATATAATAGTATCAGGAAATAGGGGAAAATAGTGTTCAACATAGTAGAACCAAGTACTCAGAGTGGTGTACAAGAGTTTAGGCCTCTATGCTTTAGATATTAGTGTCCATGCACTCTTAAAGATGAATGAATGCCTGACCTTTCCTAAAGGAAAACCTTTTTTTAGTTATCACAGGTAACATTGGTGTTGCCTGTGGGGGAGAATTTTTTACTTTCTCCCTATTTTTCTTCAGCCCACCTCAAGGCAATGTAAATAAAAGCAGTATGTGTGTTATAATAACTTATTTAGTTGTTTACTGTGTGCCAGTACCATGCTAAAGAAAGATTCTTTATCTCACATGATCCCTAATACAATTTCATGATTTTCCAATAGCCTGGATTCATCAGCATCCATTCTATCTTCTAGAGATGTTCCATGAAATCATACATTTTAATTGTTTGTGACCAAAGCATAAATCAGTGAAAGTGGAATTTGGGGACCAATAATTTCCTTTTGTGAGATGGAGAGCTTGTGTTTGAAAAGGCAACCTAATTTTTGGTTCTAATCACTTCTACCACTATTTAGTCACCAAAAAGACAATAATTCTGCATCCAAACTATTTGGACAGAATGGCTTCAAAATGCTAGCCTAAAATGTTCACATTATAAAAAGTTAAATATTACCTTCAATACCTGTCAGTAGCCTACTGACAAATTATGACTAAACAAAGGTATTTGTATGACTATGTAATAGATCATCCGCTGAAAAGTAAAACAAAATAACAAAAAAACTTGTCCTAATGGGAAAGCATGCTTAATAAAAGGAAATGCAGAAGTTATAAACATGTTTTGTAAGTAAGTATTCAGAATTAAAATTATGTGATACATTTTTATGATTGCTTAATGATCCTTGGATGTCAGATTCCTTGGGTCTATTTATAGCTAAATTATAATGAAAAATTCAAGGCTTGCTGGAGCAACTTTGTCAACAAATATATTAGTTTTGCTTATATATTTGATTTTTATGTGGAAAAATTACTACCCTTTTTTACAAGCAGAGAA