Transcript asmbl_150456

Sequence
Transcript Sequence for observation asmbl_150456 of TGE0056415:
CTATATTTAACTTGTGTTAGGCATGCGTCCGAAGAGCTGGAAGGCTGAGGATGTCAATGGCTTTCAGATGTCAGGATAACCTTAAGGATAGATGAAGGGTTGAGAGCCTGTGCCTCATTTCTGAGTTCTCAGCTGCTATGCCGTGGAAATCCTGTTTACTTTCTGCATCTGCTCCTGCAAGACTCTGGAGCCAGTCTTGAGGTCCTACATCTCCGAAAGCAAGCTCTTCTAGAAGTTGATAGCTTTCCAATGATTAGACGAATTGATTCTTTCTGTGACTCATCAGTTCATTTCCTGTAAAATTCATGTCTTGCTGTTGATTTGTGAATAAGAACCAGAGCTTGTAGAAACCACTTTAATCATATCCAGGAGTTTGCAAGAAACAGGTGCTTAACACTAATTCACCTCCTGAACAAGAAAAATGGGCTGTGACCGGAACTGTGGGCTCATCGCTGGGGCTGTCATTGGTGCTGTCCTGGCTGTGTTTGGAGGTATTCTAATGCCAGTTGGAGACCTGCTTATCCAGAAGACAATTAAAAAGCAAGTTGTCCTCGAAGAAGGTACAATTGCTTTTAAAAATTGGGTTAAAACAGGCACAGAAGTTTACAGACAGTTTTGGATCTTTGATGTGCAAAATCCACAGGAAGTGATGATGAACAGCAGCAACATTCAAGTTAAGCAAAGAGGTCCTTATACGTACAGAGTTCGTTTTCTAGCCAAGGAAAATGTAACCCAGGACGCTGAGGACAACACAGTCTCTTTCCTGCAGCCCAATGGTGCCATCTTCGAACCTTCACTATCAGTTGGAACAGAGGCTGACAACTTCACAGTTCTCAATCTGGCTGTGGCAGCTGCATCCCATATCTATCAAAATCAATTTGTTCAAATGATCCTCAATTCACTTATTAACAAGTCAAAATCTTCTATGTTCCAAGTCAGAACTTTGAGAGAACTGTTATGGGGCTATAGGGATCCATTTTTGAGTTTGGTTCCGTACCCTGTTACTACCACAGTTGGTCTGTTTTATCCTTACAACAATACTGCAGATGGAGTTTATAAAGTTTTCAATGGAAAAGATAACATAAGTAAAGTTGCCATAATCGACACATATAAAGGTAAAAGGAATCTGTCCTATTGGGAAAGTCACTGCGACATGATTAATGGTACAGATGCAGCCTCATTTCCACCTTTTGTTGAGAAAAGCCAGGTATTGCAGTTCTTTTCTTCTGATATTTGCAGGTCAATCTATGCTGTATTTGAATCCGACGTTAATCTGAAAGGAATCCCTGTGTATAGATTTGTTCTTCCATCCAAGGCCTTTGCCTCTCCAGTTGAAAACCCAGACAACTATTGTTTCTGCACAGAAAAAATTATCTCAAAAAATTGTACATCATATGGTGTGCTAGACATCAGCAAATGCAAAGAAGGGAGACCTGTGTACATTTCACTTCCTCATTTTCTGTATGCAAGTCCTGATGTTTCAGAACCTATTGATGGATTAAACCCAAATGAAGAAGAACATAGGACATACTTGGATATTGAACCTATAACTGGATTCACTTTACAATTTGCAAAACGGCTGCAGGTCAACCTATTGGTCAAGCCATCAGAAAAAATTCAAGTATTAAAGAATCTGAAGAGGAACTATATTGTGCCTATTCTTTGGCTTAATGAGACTGGGACCATTGGTGATGAGAAGGCAAACATGTTCAGAAGTCAAGTAACTGGAAAAATAAACCTCCTTGGCCTGATAGAAATGATCTTACTCAGTGTTGGTGTGGTGATGTTTGTTGCTTTTATGATTTCATATTGTGCATGCAGATCGAAAACAATAAAATAAGTAAGTATGTACCAAAAAATATTGCTTCAATAATATTAGCTTATATATTACTTGTTTTCACTTTATCAAAGAGAAGTTACATATTAGGCCATATATATTTCTAGACATGTCTAGCCACTGATCATTTTTAAATATAGGTAAATAAACCTATAAATATTATCACGCAGATCACTAAAGTATATCTTTAATTCTGGGAGAAATGAGATAAAAGATGTACTTGTGACCATTGTAACAATAGCACAAATAAAGCACTTGTGCCAAAGTTGTCCAAAATTGACTGGTTCATTTCTCAATTATATAGCTAGTTATATATTATCTGATACTTAAAAATAATTGACTAGGAAATGGTTTCATAAGACCAGGATTGCTGCATGTAGACATGCTGGCCGTGCATTTTCCAAATCCAGAAAAGTCCTGAACAAAAATTTGAATATAATAGTATCAGGAAATAGGGGAAAATAGTGTTCAACATAGTAGAACCAAGTACTCAGAGTGGTGTACAAGAGTTTAGGCCTCTATGCTTTAGATATTAGTGTCCATGCACTCTTAAAGATGAATGAATGCCTGACCTTTCCTAAAGGAAAACCTTTTTTTAGTTATCACAGGTAACATTGGTGTTGCCTGTGGGGGAGAATTTTTTACTTTCTCCCTATTTTTCTTCAGCCCACCTCAAGGCAATGTAAATAAAAGCAGTATGTGTGTTATAATAACTTATTTAGTTGTTTACTGTGTGCCAGTACCATGCTAAAGAAAGATTCTTTATCTCACATGATCCCTAATACAATTTCATGATTTTCCAATAGCCTGGATTCATCAGCATCCATTCTATCTTCTAGAGATGTTCCATGAAATCATACATTTTAATTGTTTGTGACCAAAGCATAAATCAGTGAAAGTGGAATTTGGGGACCAATAATTTCCTTTTGTGAGATGGAGAGCTTGTGTTTGAAAAGGCAACCTAATTTTTGGTTCTAATCACTTCTACCACTATTTAGTCACCAAAAAGACAATAATTCTGCATCCAAACTATTTGGACAGAATGGCTTCAAAATGCTAGCCTAAAATGTTCACATTATAAAAAGTTAAATATTACCTTCAATACCTGTCAGTAGCCTACTGACAAATTATGACTAAACAAAGGTATTTGTATGACTATGTAATAGATCATCCGCTGAAAAGTAAAACAAAATAACAAAAAAACTTGTCCTAATGGGAAAGCATGCTTAATAAAAGGAAATGCAGAAGTTATAAACATGTTTTGTAAGTAAGTATTCAGAATTAAAATTATGTGATACATTTTTATGATTGCTTAATGATCCTTGGATGTCAGATTCCTTGGGTCTATTTATAGCTAAATTATAATGAAAAATTCAAGGCTTGCTGGAGCAACTTTGTCAACAAATATATTAGTTTTGCTTATATATTTGATTTTTATGTGGAAAAATTACTACCCTTTTTTACAAGCAGAGAA