Transcript asmbl_150455

Sequence
Transcript Sequence for observation asmbl_150455 of TGE0056415:
GGGTCTTCACCAGAACATAAAAATAGACCCTTATTAGCCATATCAGTAATGTGCTGTGTGGGGGATTTTTTTTTTCTTTCAATTCCTCTGGCAACAAACCACACACTGGGATCTGACACTGTAGAGTGCTTTCTCTTCTCTTTTTTTGGGGGGGGGAGGGGGTGTGGTTGCATATTTAAACTCTCACGCATTTATGTACTGAGGACTGCAGTGTAGGACTTTCCTGCAGAATACCATTTGATCCTATTAAGAATTGTCCAAATGTTGGAGCATTTGATTGAAAAATCCTTCTTAGCCATTTTAAAGATAGCTTTCCAATGATTAGACGAATTGATTCTTTCTGTGACTCATCAGTTCATTTCCTGTAAAATTCATGTCTTGCTGTTGATTTGTGAATAAGAACCAGAGCTTGTAGAAACCACTTTAATCATATCCAGGAGTTTGCAAGAAACAGGTGCTTAACACTAATTCACCTCCTGAACAAGAAAAATGGGCTGTGACCGGAACTGTGGGCTCATCGCTGGGGCTGTCATTGGTGCTGTCCTGGCTGTGTTTGGAGGTATTCTAATGCCAGTTGGAGACCTGCTTATCCAGAAGACAATTAAAAAGCAAGTTGTCCTCGAAGAAGGTACAATTGCTTTTAAAAATTGGGTTAAAACAGGCACAGAAGTTTACAGACAGTTTTGGATCTTTGATGTGCAAAATCCACAGGAAGTGATGATGAACAGCAGCAACATTCAAGTTAAGCAAAGAGGTCCTTATACGTACAGAGTTCGTTTTCTAGCCAAGGAAAATGTAACCCAGGACGCTGAGGACAACACAGTCTCTTTCCTGCAGCCCAATGGTGCCATCTTCGAACCTTCACTATCAGTTGGAACAGAGGCTGACAACTTCACAGTTCTCAATCTGGCTGTGGCAGCTGCATCCCATATCTATCAAAATCAATTTGTTCAAATGATCCTCAATTCACTTATTAACAAGTCAAAATCTTCTATGTTCCAAGTCAGAACTTTGAGAGAACTGTTATGGGGCTATAGGGATCCATTTTTGAGTTTGGTTCCGTACCCTGTTACTACCACAGTTGGTCTGTTTTATCCTTACAACAATACTGCAGATGGAGTTTATAAAGTTTTCAATGGAAAAGATAACATAAGTAAAGTTGCCATAATCGACACATATAAAGGTAAAAGGAATCTGTCCTATTGGGAAAGTCACTGCGACATGATTAATGGTACAGATGCAGCCTCATTTCCACCTTTTGTTGAGAAAAGCCAGGTATTGCAGTTCTTTTCTTCTGATATTTGCAGGTCAATCTATGCTGTATTTGAATCCGACGTTAATCTGAAAGGAATCCCTGTGTATAGATTTGTTCTTCCATCCAAGGCCTTTGCCTCTCCAGTTGAAAACCCAGACAACTATTGTTTCTGCACAGAAAAAATTATCTCAAAAAATTGTACATCATATGGTGTGCTAGACATCAGCAAATGCAAAGAAGGGAGACCTGTGTACATTTCACTTCCTCATTTTCTGTATGCAAGTCCTGATGTTTCAGAACCTATTGATGGATTAAACCCAAATGAAGAAGAACATAGGACATACTTGGATATTGAACCTATAACTGGATTCACTTTACAATTTGCAAAACGGCTGCAGGTCAACCTATTGGTCAAGCCATCAGAAAAAATTCAAGTATTAAAGAATCTGAAGAGGAACTATATTGTGCCTATTCTTTGGCTTAATGAGACTGGGACCATTGGTGATGAGAAGGCAAACATGTTCAGAAGTCAAGTAACTGGAAAAATAAACCTCCTTGGCCTGATAGAAATGATCTTACTCAGTGTTGGTGTGGTGATGTTTGTTGCTTTTATGATTTCATATTGTGCATGCAGATCGAAAACAATAAAATAAGTAAGTATGTACCAAAAAATATTGCTTCAATAATATTAGCTTATATATTACTTGTTTTCACTTTATCAAAGAGAAGTTACATATTAGGCCATATATATTTCTAGACATGTCTAGCCACTGATCATTTTTAAATATAGGTAAATAAACCTATAAATATTATCACGCAGATCACTAAAGTATATCTTTAATTCTGGGAGAAATGAGATAAAAGATGTACTTGTGACCATTGTAACAATAGCACAAATAAAGCACTTGTGCCAAAGTTGTCCAAAATTGACTGGTTCATTTCTCAATTATATAGCTAGTTATATATTATCTGATACTTAAAAATAATTGACTAGGAAATGGTTTCATAAGACCAGGATTGCTGCATGTAGACATGCTGGCCGTGCATTTTCCAAATCCAGAAAAGTCCTGAACAAAAATTTGAATATAATAGTATCAGGAAATAGGGGAAAATAGTGTTCAACATAGTAGAACCAAGTACTCAGAGTGGTGTACAAGAGTTTAGGCCTCTATGCTTTAGATATTAGTGTCCATGCACTCTTAAAGATGAATGAATGCCTGACCTTTCCTAAAGGAAAACCTTTTTTTAGTTATCACAGGTAACATTGGTGTTGCCTGTGGGGGAGAATTTTTTACTTTCTCCCTATTTTTCTTCAGCCCACCTCAAGGCAATGTAAATAAAAGCAGTATGTGTGTTATAATAACTTATTTAGTTGTTTACTGTGTGCCAGTACCATGCTAAAGAAAGATTCTTTATCTCACATGATCCCTAATACAATTTCATGATTTTCCAATAGCCTGGATTCATCAGCATCCATTCTATCTTCTAGAGATGTTCCATGAAATCATACATTTTAATTGTTTGTGACCAAAGCATAAATCAGTGAAAGTGGAATTTGGGGACCAATAATTTCCTTTTGTGAGATGGAGAGCTTGTGTTTGAAAAGGCAACCTAATTTTTGGTTCTAATCACTTCTACCACTATTTAGTCACCAAAAAGACAATAATTCTGCATCCAAACTATTTGGACAGAATGGCTTCAAAATGCTAGCCTAAAATGTTCACATTATAAAAAGTTAAATATTACCTTCAATACCTGTCAGTAGCCTACTGACAAATTATGACTAAACAAAGGTATTTGTATGACTATGTAATAGATCATCCGCTGAAAAGTAAAACAAAATAACAAAAAAACTTGTCCTAATGGGAAAGCATGCTTAATAAAAGGAAATGCAGAAGTTATAAACATGTTTTGTAAGTAAGTATTCAGAATTAAAATTATGTGATACATTTTTATGATTGCTTAATGATCCTTGGATGTCAGATTCCTTGGGTCTATTTATAGCTAAATTATAATGAAAAATTCAAGGCTTGCTGGAGCAACTTTGTCAACAAATATATTAGTTTTGCTTATATATTTGATTTTTATGTGGAAAAATTACTACCCTTTTTTACAAGCAGAGAA