Transcript asmbl_150451

Sequence
Transcript Sequence for observation asmbl_150451 of TGE0058553:
AAAAAAAGAAAAGAAAAAGAAAAAGGTTAGGGAAGCCAGATTGAGCAGGATTTTGAAGACACGGTGTCAAATTTGTGTTCTTCATGTAGATATTTTTATTTTCTTAATGTAGTGAGTGTTAAGTACCATCCTCTGAAGTGTCCAACTCTTGAAGGAAAAGAAAAAGCTTCCAATACCATTAGATTTTTCACTCAGTTTTTGTGTTTTGTTTCATCAGTCCAACTTAGGGGCAGAGAAGAAGTTCAACTCAGTAAGAACTTTTTTGAACTTCGGTAAAATTTGCTTAATAAATTATGTTGACTGTTGCAATATTTTCAAAGCGTCACTCTAAAGCTTGCCGAAGGGTCACTTTAAAGTTTGCCTTAAAATCAACAGTCGTGTCTTCAGTATTACACACTGATTCTCTTTGTAAAAGGCTAAAAAGACTGCTGTAATAATAATTTGTTGAAAACATTTCTGCTGCAAGTGTATGGTAAGGTTGCAAAGGTTCTCATGAATGAGGTACTTGGGCTTGGTCCTTTTATTCTGGCTGACTCAAGGCTGCAAACAATCTTCCAGAAGTGCCTGTACTTACTACAAAGACATAACCCAAACTTATTTTCTTTTTCATAGCAAGTTGTCCTCGAAGAAGGTACAATTGCTTTTAAAAATTGGGTTAAAACAGGCACAGAAGTTTACAGACAGTTTTGGATCTTTGATGTGCAAAATCCACAGGAAGTGATGATGAACAGCAGCAACATTCAAGTTAAGCAAAGAGGTCCTTATACGTACAGAGTTCGTTTTCTAGCCAAGGAAAATGTAACCCAGGACGCTGAGGACAACACAGTCTCTTTCCTGCAGCCCAATGGTGCCATCTTCGAACCTTCACTATCAGTTGGAACAGAGGCTGACAACTTCACAGTTCTCAATCTGGCTGTGGCAGCTGCATCCCATATCTATCAAAATCAATTTGTTCAAATGATCCTCAATTCACTTATTAACAAGTCAAAATCTTCTATGTTCCAAGTCAGAACTTTGAGAGAACTGTTATGGGGCTATAGGGATCCATTTTTGAGTTTGGTTCCGTACCCTGTTACTACCACAGTTGGTCTGTTTTATCCTTACAACAATACTGCAGATGGAGTTTATAAAGTTTTCAATGGAAAAGATAACATAAGTAAAGTTGCCATAATCGACACATATAAAGGTAAAAGGAATCTGTCCTATTGGGAAAGTCACTGCGACATGATTAATGGTACAGATGCAGCCTCATTTCCACCTTTTGTTGAGAAAAGCCAGGTATTGCAGTTCTTTTCTTCTGATATTTGCAGGTCAATCTATGCTGTATTTGAATCCGACGTTAATCTGAAAGGAATCCCTGTGTATAGATTTGTTCTTCCATCCAAGGCCTTTGCCTCTCCAGTTGAAAACCCAGACAACTATTGTTTCTGCACAGAAAAAATTATCTCAAAAAATTGTACATCATATGGTGTGCTAGACATCAGCAAATGCAAAGAAGGGAGACCTGTGTACATTTCACTTCCTCATTTTCTGTATGCAAGTCCTGATGTTTCAGAACCTATTGATGGATTAAACCCAAATGAAGAAGAACATAGGACATACTTGGATATTGAACCTGTAAGAAAACACCTTATTGATCTGATTTGGTTGATATTTTTAAAAATACAATTGAAATAAAAATAATCTTGTCGATGATTATTTATTCAATAAATAATCATATTTATTGAATCACATTCTTGAAAGTTACTGAAACTTAGGTCGATTTCTTCCTATGGTTTATGAAGTGATTCTAATTGGCTTAAAATAATTTTATATAAATATTTATGTTTAGATGAGGAGTTATTGTATATTATGCAAAAGTCAAAGAGTATATGTGAGTTTGACTATACTTATTGTCAAAATCTATAAAATTGTTGTAGCGCAACAGTTTTAATCATCTTTATTTTTGTATTTTCCTTTTCAAAAAGTAAATGAAATTCTAGGATTTTAGTAGTTATGTTTTAGTTTAAACAATGACACATGGATTCTAACTGAATATATATTTGACCAGGAATTATCTGAGATCTTATATTTTGTTGCTGATTTTTGATTTTTTAAAAACCATTTCAAGTAACTCACAAATCTAACTAACTAAAACCTTGACATTCGATTGGGCAAATAAATTGTGTGTATCTATATGGATGCATGTGTATATAACTATAACTATATATGCAGTTTTAAAAGTTTCAATTAGTCCTGTTTAACCTTAAGTTACTACCTTCTCTTCTGCTGTAAGAAAAATAAGTTTTGAATAGTATAAAATAATGTTTTTAAAAGTTGGTAATTATTTAGTTGTTCTCTTTTTAGATAACTGGATTCACTTTACAATTTGCAAAACGGCTGCAGGTCAACCTATTGGTCAAGCCATCAGAAAAAATTCAGTGAGTCTCTTGAAAATGGTTATTTTGATATGATCTGTAGTATCGTAGTATCTTCTTGTAAGAACATGAGTAAATCTATGTAAGTAAGTGGAAATAACATCTGATATCAACTTATCTTTAGCTTAATGTCACCAATCATTATTAAATGCTTATGACTAATTTCACAGATTTTGGAATGGTTTTATGGTTTTATTTGAGCATTTGATAGCATCTCTTATTTTGTTAGCTGCCCAAATATTTCTATGACAATAATTAATTTTTGGAATTCATATTTCAGTTCCCCGAGAATTTATTGAAAGGAAAAATCCACACTTGTGAAAAAAAATCAATGTGATTAGAAGACATATAAGAGCAAAGGAAGTCAAAAACAACTATATTAAAATTTAAATGAGTCATTACAGGAACAAAATCAAATTAGCAACAGCAACTAATTTATGAACATTTATTTTAAAGTTTGTTATATATAAATATTAGTTTATATGTTCATAATTATTTTCAACGTATATTACAGAGTATTAAAGAATCTGAAGAGGAACTATATTGTGCCTATTCTTTGGCTTAATGAGACTGGGACCATTGGTGATGAGAAGGCAAACATGTTCAGAAGTCAAGTAACTGGAAAAATAAACCTCCTTGGCCTGATAGAAATGATCTTACTCAGTGTTGGTGTGGTGATGTTTGTTGCTTTTATGATTTCATATTGTGCATGCAGATCGAAAACAATAAAATAAGTAAGTATGTACCAAAAAATATTGCTTCAATAATATTAGCTTATATATTACTTGTTTTCACTTTATCAAAGAGAAGTTACATATTAGGCCATATATATTTCTAGACATGTCTAGCCACTGATCATTTTTAAATATAGGTAAATAAACCTATAAATATTATCACGCAGATCACTAAAGTATATCTTTAATTCTGGGAGAAATGAGATAAAAGATGTACTTGTGACCATTGTAACAATAGCACAAATAAAGCACTTGTGCCAAAGTTGTCCAAAATTGACTGGTTCATTTCTCAATTATATAGCTAGTTATATATTATCTGATACTTAAAAATAATTGACTAGGAAATGGTTTCATAAGACCAGGATTGCTGCATGTAGACATGCTGGCCGTGCATTTTCCAAATCCAGAAAAGTCCTGAACAAAAATTTGAATATAATAGTATCAGGAAATAGGGGAAAATAGTGTTCAACATAGTAGAACCAAGTACTCAGAGTGGTGTACAAGAGTTTAGGCCTCTATGCTTTAGATATTAGTGTCCATGCACTCTTAAAGATGAATGAATGCCTGACCTTTCCTAAAGGAAAACCTTTTTTTAGTTATCACAGGTAACATTGGTGTTGCCTGTGGGGGAGAATTTTTTACTTTCTCCCTATTTTTCTTCAGCCCACCTCAAGGCAATGTAAATAAAAGCAGTATGTGTGTTATAATAACTTATTTAGTTGTTTACTGTGTGCCAGTACCATGCTAAAGAAAGATTCTTTATCTCACATGATCCCTAATACAATTTCATGATTTTCCAATAGCCTGGATTCATCAGCATCCATTCTATCTTCTAGAGATGTTCCATGAAATCATACATTTTAATTGTTTGTGACCAAAGCATAAATCAGTGAAAGTGGAATTTGGGGACCAATAATTTCCTTTTGTGAGATGGAGAGCTTGTGTTTGAAAAGGCAACCTAATTTTTGGTTCTAATCACTTCTACCACTATTTAGTCACCAAAAAGACAATAATTCTGCATCCAAACTATTTGGACAGAATGGCTTCAAAATGCTAGCCTAAAATGTTCACATTATAAAAAGTTAAATATTACCTTCAATACCTGTCAGTAGCCTACTGACAAATTATGACTAAACAAAGGTATTTGTATGACTATGTAATAGATCATCCGCTGAAAAGTAAAACAAAATAACAAAAAAACTTGTCCTAATGGGAAAGCATGCTTAATAAAAGGAAATGCAGAAGTTATAAACATGTTTTGTAAGTAAGTATTCAGAATTAAAATTATGTGATACATTTTTATGATTGCTTAATGATCCTTGGATGTCAGATTCCTTGGGTCTATTTATAGCTAAATTATAATGAAAAATTCAAGGCTTGCTGGAGCAACTTTGTCAACAAATATATTAGTTTTGCTTATATATTTGATTTTTATGTGGAAAAATTACTACCCTTTTTTACAAGCAGAGAA