Transcript asmbl_150449

Sequence
Transcript Sequence for observation asmbl_150449 of TGE0058552:
CGGCGGCGCGCGGAGGCCGAGCTCGGCTGGGCTTGGCGAGGCTGCGGCGCGGCCACCGGCGGGAGTGCAGCGGCCACTGTACCCAGAGATTCAAAACCCCAAACCCGGGACTTGGGGGCGCTGAGCCGGGCCGGGAAGCAGAGCCTGGTCGTGAGGAACAGCCGCCCGTTGCTGTCTGCCCCTTTGCGGACAGCGTCTCCCTCGACTCCGCTTAGGAAGTGGTGGGGGCGGCGTGGCCCCCGTCGGGAGGCGTTCGAACGCCCGCTAGGAGAGAGAAAGGATTCCCCTGTGCTTGGAGCCCGCACTCGGGCGCGGAGGGAGCGGCGGCAGGCTCTCGCTTTCGGCACCATGGGCTGCACGCTGAGCGCCGAGGACAAGGCGGCGGTGGAGCGGAGTAAGATGATCGACCGCAACCTCCGTGAGGACGGCGAGAAGGCGGCGCGCGAGGTCAAGCTGCTGCTGCTCGGTGCTGGTGAATCTGGTAAAAGTACAATTGTGAAGCAGATGAAAATTATCCATGAAGCTGGTTATTCAGAAGAGGAGTGTAAACAATACAAAGCAGTGGTCTACAGTAACACCATCCAGTCAATTATTGCTATCATTAGGGCTATGGGGAGGTTGAAGATAGACTTTGGTGACTCAGCCCGGGCGGATGATGCACGCCAACTCTTTGTGCTAGCTGGAGCTGCTGAAGAAGGCTTTATGACTGCAGAACTTGCTGGAGTTATAAAGAGATTGTGGAAAGATAGTGGTGTACAAGCCTGTTTCAACAGATCCCGAGAGTACCAGCTTAATGATTCTGCAGCATACTATTTGAATGACTTGGACAGAATAGCTCAACCAAATTACATCCCGACTCAACAAGATGTTCTCAGAACTAGAGTGAAAACTACAGGAATTGTTGAAACCCATTTTACTTTCAAAGATCTTCATTTTAAAATGTTTGATGTGGGAGGTCAGAGATCTGAGCGGAAGAAGTGGATTCATTGCTTCGAAGGAGTGACGGCGATCATCTTCTGTGTAGCACTGAGTGACTACGACCTGGTTCTAGCTGAAGATGAAGAAATGAACCGAATGCATGAAAGCATGAAATTGTTTGACAGCATATGTAACAACAAGTGGTTTACAGATACATCCATTATACTTTTTCTAAACAAGAAGGATCTCTTTGAAGAAAAAATCAAAAAGAGCCCTCTCACTATATGCTATCCAGAATATGCAGGATCAAACACATATGAAGAGGCAGCTGCATATATTCAATGTCAGTTTGAAGACCTCAATAAAAGAAAGGACACAAAGGAAATATACACCCACTTCACATGTGCCACAGATACTAAGAATGTGCAGTTTGTTTTTGATGCTGTAACAGATGTCATCATAAAAAATAATCTAAAAGATTGTGGTCTCTTTTAAGTTTTGCAGTTCATGGTAAAATGCATTTTCAAACCAAATGAGTACTTATATATGGATCTCTGTAGACTAGAGTCTTGCAGCAACACAGAATGTAATATAAGGCAAATGCATCTGGGACTTGACCAAAGTTGTTCTGTTTTGTTTTTTTAACTGAAAGTAACAGAAGGACCTTTCTTAAATGTGACAGATGGTCCTGCAGTGTGAAACTGAAGGACAGTGTTAAAGCTGGGCTCTAGTATATTGATGATTTCTGCATAAGTGTAAATATGCAAATGTATGTATACATGTATTTATGACTTTAGTTTTCGACATTATTTTTAGGTTTTAAGAGTGGCAACTTAGGATTTTAGGGTGATGGCTTTGGAAATAACATAAATATACCTTGTACTGAATGACAGACTATTACTACGTTTGCCAGTTTTAAACAGCTTTATTTATGTTCATGTCCTGTAAATTTTTAAGTACAGTAATTAATATTAGGAAACATTACAGCCCTTATCTAGATTATATGTATACTTGTATTAATAAAAATGTTATTTGTACAAACATTGCACAGACTATTTTAATAACATGATTTGTTCTTTAAATTTTATGTGTTTTATTGAAATGTTCTTAAGATGAATACACCTGCCTTTGGATCAACTATTTAAACATTGTATGCATTTTGATTTTTCCTACTTTAAGAAAATAAAATAATTTAATTTTACATTAGATTCCACGTTAGATTTGGTTTGAAAAACTAAAATTTCAGATTTCTGAGGATATACTGTCTTAGACTTATTGTACACACTTAGTTTTTATTCACTTGTTTTCACTCTGAATTTTAATATTTGGCTGATATGAATGCATTGCCTCAAAGGTGATGTCATCTTAATTTTTATTCACTTTAAATAACTACATTTTTGTTTATAACTAAGTTTGGAGGGATCCTAAGAGCATTTTTGTGGGTAAAAAAAAAACCTGTGGACATAATGAATTTTGAGACATTGATTGGTGAGGCTTTTATTTCCCTTGAGGAGTCTCTTGTACCTAGCATACATGATAGCTCCTTGTTGGGAAGATAACAAGAAGGATCTTTGAATACTCTATTGCTGATATAATGCAAGATTTAAATTTATACATATAACTAATTTCAAATGTAATTATCACACTATGTTAAAATTACTTTTTTCCCTTAGATAATTCAAATTTCTCCACTTGCTTGAGATTATATCATTTCTTTTTCAATTATACTATTATTTCTGAGAATGAAATGGACGATTACACTTAGAAAATGAGTAATAGTGTTTAATAAGTCAGTGATTATATGTGTGCTCAAATAAGTGTTATGTATCAGCTAGATACTGAGCTTTGATAGAATAATTTTCTTTTGATTATTCATGATGTGTCATCTCTGACCTTGTTTCAGCAAAGTAAACAGCACTCCCCACCCCACCCTCCTTTTTTTACTCATCTTGGAAAAGGTTAGTCTTTCAGTACACGTTGCTGGTAAGTAGTTTCCAAGTTACGTGTTGTCACTGGGTTGAAGTATATTTGTGTGTGTGTGTGTGTGTG