Transcript asmbl_150415

Sequence
Transcript Sequence for observation asmbl_150415 of TGE0058551:
AGAGAGCAGGCGCTGGGCAGTGTGGAGGTCGTTGGAGTCACTTCCCCGTCACCAGCTCCTGTGCCTGCCAGTCGGTGCCCCTCCCGCTCCAGCCATGCTCTCCGCCCTCGCCCGGCCTGCCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCGGCCCAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCACTTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCCGGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGACCTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGGTAGTTATTCCGGCTGGAGTCCCCAGAAAGCCAGGCATGACCCGGGACGACCTGTTCAACACCAATGCCACGATTGTGGCCACCCTGACCGCTGCCTGTGCCCAGCACTGCCCGGAAGCCATGATCTGCGTCATTGCCAATCCGGTTAATTCCACCATCCCCATCACAGCAGAAGTTTTCAAGAAGCATGGAGTGTACAACCCCAACAAAATCTTCGGCGTGACGACCCTGGACATCGTCAGAGCCAACACCTTTGTTGCAGAGCTGAAGGGTTTGGATCCAGCTCGAGTCAACGTCCCTGTCATTGGTGGCCATGCTGGGAAGACCATCATCCCCCTGATCTCTCAGTGCACCCCCAAGGTGGACTTTCCCCAGGACCAGCTGACAGCACTCACTGGGCGGATCCAGGAGGCCGGCACGGAGGTGGTCAAGGCTAAAGCCGGAGCAGGCTCTGCCACCCTCTCCATGGCGTATGCCGGCGCCCGCTTTGTCTTCTCCCTTGTGGATGCAATGAATGGAAAGGAAGGTGTTGTGGAATGTTCCTTCGTTAAGTCACAGGAAACGGAATGTACCTACTTCTCCACACCGCTGCTGCTTGGGAAAAAGGGCATCGAGAAGAACCTGGGCATCGGCAAAGTCTCCTCTTTTGAGGAGAAGATGATCTCGGATGCCATCCCCGAGCTGAAGGCCTCCATCAAGAAGGGGGAAGATTTCGTGAAGACCCTGAAGTGAGCCGCTGTGACGGGTGGCCAGTTTCCTTAATTTATGAAGGCATCATGTCACTGCAAAGCCGTTGCAGATAAACTTTGTATTTTAATTTGCTTTGGTGATGATTACTGTATTGACATCATCATGCCTTCCAAATTGTGGGTGGCTCTGTGGGCGCATCAATAAAAGCCGTCCTTGATTTTATTTTTCAAGGTCCCTTCTGTAAATGCTGTGCTTTCTTCCCTGTGAGAGCCAACTTTAGAGTGTCTGCTACCTCTTCATTACCAATCAGAATTAGATGATGTTTAACTGTTAGACTGAAGCGTGACGCTTTCATCAGTAGCTTCAAGAAAGTCTAAATTGTTAATTTATGGAATTGGACACAGTATTCAGTTTACCCGTACATGCTCCTCCCGCCCCTCCTGTTGGCACCCTTGCATCGCCCAGGCCTGATTCCTCCTGGGGGTAGTTCACCCCCACGGGTTCATAGTTCAGCGGCGAATGCCAGGCAGCTGTTTTCTGGCTGAGCAAACAGCACCTTTCTCATTGAGCTTCCTCTACTGACCTCTGTCCCCCTTGGGATTTCATCTTCTGACCGAACCCTGATGTTCAGTGGCAGAGACAGCCCATAGCCAGAACTGTGGGTAGACCAGGGTTGGGGTGTGCGGTTTGGGACAGCCCAAACCCCAGCCGCTGTGTCAAGGCCTAGGACGCCATGCTGCCATCAAAAGGGGGTTCCAGGTTTCCATCAGTGGCCTAAAGAAGGGACTTCTTGTTGTACTGAGGAGTGCGGAATTAAAGAGATTTGACTCCCTTTAGTATTGGGGGCAGTCCGTTCCCCAGACACTGTGGCCTCTGAAGTGGAAACTGAAAGCTGCATACCTGGGAAAGAACTTTCTAGGAATAGGCAATGGCCTTCAGTGGAAGAGGGAGGGCTGGAGGTGTGCCCAGTACTTGGATGTTCATCTGTCCACAACAGCTTTTTGTTTTTTTAAAAAAGCTAAAATGGAAATGGATTTTATCATAAAGGATGACATCGTTTTCTTCTACAATTAATACATGTTCATTGTATAAAACCCAAAAAGCAGCTAAAAAATAAAGCGGGAAAGGAACTACTGG