Transcript asmbl_150168

Sequence
Transcript Sequence for observation asmbl_150168 of TGE0058550:
TGTGGAGGAGTCCGCCTGCTGTAGCGTGCGTAAGCAAGGCAGCTACGCCGGGCGGCTACGCTGCGGAATCGGCGTAGGCGCCTTTGGAGAATCGGCGGGCTGCGCTCCGCTGGGGCTGGTCGCGGAGGGGGGGAGGGGATGTCGGTCAGTGCGAGATCCGCTGCTGCTGAGGAGAGGAGCGTCAACAGCAGCACCATGGTAGCTCAACAGAAGAACCTTGAAGGCTATGTGGGATTTGCCAATCTCCCAAATCAAGTATACAGAAAATCGGTGAAGAGAGGTTTTGAATTCACGCTTATGGTAGTGGGTGAATCTGGATTGGGAAAGTCGACATTAATCAACTCATTATTCCTCACAGATTTGTATTCTCCAGAGTATCCAGGTCCTTCTCATAGAATTAAAAAGACTGTACAGGTGGAACAATCCAAAGTTTTAATCAAAGAAGGTGGTGTTCAGTTGCTGCTCACAATAGTTGATACCCCAGGATTTGGAGATGCAGTGGATAATAGTAATTGCTGGCAGCCTGTTATCGACTACATTGATAGTAAATTTGAGGACTACCTAAATGCAGAATCACGAGTGAACAGACGTCAGATGCCTGATAACAGGGTGCAGTGTTGTTTATACTTCATTGCTCCTTCAGGACATGGACTTAAACCATTGGATATTGAGTTTATGAAGCGTTTGCATGAAAAAGTGAATATCATCCCACTTATTGCCAAAGCAGACACACTCACACCAGAGGAATGCCAACAGTTTAAAAAACAGATAATGAAAGAAATCCAAGAACATAAAATTAAAATATACGAATTTCCAGAAACAGATGATGAAGAAGAAAATAAACTTGTTAAAAAGATAAAGGACCGTTTACCTCTTGCTGTGGTAGGTAGTAATACTATCATTGAAGTTAATGGCAAAAGGGTCAGAGGAAGGCAGTATCCTTGGGGTGTTGCTGAAGTTGAAAATGGTGAACATTGTGATTTTACAATCCTAAGAAATATGTTGATAAGAACACACATGCAGGACTTGAAAGATGTTACTAATAATGTCCACTATGAGAACTACAGAAGCAGAAAACTTGCAGCTGTGACTTATAATGGAGTTGATAACAACAAGAATAAAGGGCAGCTGACTAAGAGCCCTCTGGCACAAATGGAAGAAGAAAGAAGGGAGCATGTAGCTAAAATGAAGAAGATGGAGATGGAGATGGAGCAGGTGTTTGAGATGAAGGTCAAAGAAAAAGTTCAAAAACTGAAGGACTCTGAAGCTGAGCCTGCAGATGTGGATCCTGACTCCTGAGAGAAGTAGCTCACCGTGACAAAGCTGTCTTTGCTTTTATCGATTTGCAAATCAAAGAAGGGGGACATATTGGGAGCAGGCCTCCCAAAATCTGGCCATAAAC