Transcript asmbl_149138

Sequence
Transcript Sequence for observation asmbl_149138 of TGE0058537:
TTGCCCGAGGTGACGCCAGCCCAGGGGCCCCACCCCGCCTTGGGGAGCTGTGGGTGACAGACCCCACCCCAGACTCACTGCGCCTCTCCTGGACGGTTCCTGAGGGCCAGTTCGACTCTTTTGTGGTCCAGTTCAAGGACAAAGACGGGCCCCAGGTGGTGCCCGTGGAGGGCAGCCTCAGGGAGGTCAGCGTGCCGGGCCTGGACCCTGCCCACAGGTACAAGCTGCTGCTCTACGGGCTGCACCACGGCAAGCGTGTGGGCCCCATCTCGGCCGTCGCCATTACTGCCGGCAGGGAAGAAACGGAAACTGAGACCACGGCCCCGACCCCTCCAGCGCCTGAGCCCCACCTCGGGGAGTTGACAGTGGAGGAGGCCACGTCACACACCCTGCATCTCTCCTGGATGGTGACTGAGGGAGAATTTGACTCCTTCGAAATCCAGTACACAGATAGAGACGGGCAACTCCAAATGGTCCGCATAGGAGGTGACCGGAATGACATCACCCTCTCTGGCCTGGAATCCGACCACAGATACCTGGTGACCCTGTATGGTTTCAGTGATGGGAAGCATGTAGGTCCTGTCCATGTCGAGGCCCTGACAGTCCCGGAGGAGGAGAAGCCTTCAGAACCTCCCACCGCAACCCCCGAGCCCCCCATCAAGCCTCGCCTGGGGGAGCTGACCGTGACAGATGCCACCCCTGACTCCCTCAGCCTGTCCTGGACAGTTCCCGAGGGACAGTTTGACCACTTCCTGGTCCAGTACAGGAATGGAGATGGGCAGCCCAAGGCAGTGAGGGTGCCAGGGCACGAGGAAGGGGTCACCATCTCGGGCCTGGAGCCAGACCATAAATACAAGATGAACCTGTACGGCTTCCACGGTGGCCAGCGCATGGGCCCTGTGTCTGTCGTCGGGGTGACAGCTGCAGAGGAAGAGACCCCCAGCCCCACAGAACCCAGCATGGAGGCCCCGGAGCCCGCTGAGGAGCCGCTCCTGGGGGAGCTAACAGTGACAGGATCCTCCCCTGACTCGCTGAGCCTCTCCTGGACCGTCCCCCAGGGCCGCTTCGACTCCTTCACCGTGCAGTACAAGGACAGGGA