Transcript asmbl_148172

Sequence
Transcript Sequence for observation asmbl_148172 of TGE0058548:
TCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACGTTGCTCACTATTACGTATAATCCTTTTCTTTTCAAGATGCCTGAGGAAGTGCACCATGGAGAGGAGGAGGTGGAGACTTTTGCCTTTCAGGCAGAAATTGCCCAACTCATGTCCCTCATCATCAATACCTTCTATTCCAACAAGGAGATTTTCCTTCGGGAGTTGATCTCTAATGCTTCTGATGCCTTGGACAAGATTCGCTATGAGAGCCTGACAGACCCTTCGAAGTTGGACAGTGGTAAAGAGCTGAAAATTGACATCATCCCCAACCCTCAGGAACGTACCCTGACTTTGGTAGACACAGGCATTGGCATGACCAAAGCTGATCTCATAAATAATTTGGGAACCATTGCCAAGTCTGGTACTAAAGCATTCATGGAGGCTCTTCAGGCTGGTGCAGACATCTCCATGATTGGGCAGTTTGGTGTTGGCTTTTATTCTGCCTACTTGGTGGCAGAGAAAGTGGTTGTGATCACAAAGCACAACGATGATGAACAGTATGCTTGGGAGTCTTCTGCTGGAGGTTCCTTCACTGTGCGTGCTGACCATGGTGAGCCCATTGGCAGGGGTACCAAAGTGATCCTCCATCTTAAAGAAGATCAGACAGAGTACCTAGAAGAGAGGCGGGTCAAAGAAGTAGTGAAGAAGCATTCTCAGTTCATAGGCTATCCCATCACCCTTTATTTGGAGAAGGAACGAGAGAAGGAAATTAGTGATGATGAGGCAGAGGAAGAGAAAGGTGAGAAAGAAGAGGAAGATAAAGATGATGAAGAAAAACCCAAGATCGAAGATGTGGGTTCAGATGAGGAGGATGACAGCGGTAAGGATAAGAAGAAGAAAACTAAGAAGATCAAAGAGAAATACATTGATCAGGAAGAACTAAACAAGACCAAGCCTATTTGGACCAGAAACCCTGATGACATCACCCAAGAGGAGTATGGAGAATTCTACAAGAGCCTCACTAATGACTGGGAAGACCACTTGGCAGTCAAGCACTTTTCTGTAGAAGGTCAGTTGGAATTCAGGGCATTGCTATTTATTCCTCGTCGGGCTCCCTTTGACCTTTTTGAGAACAAGAAGAAAAAGAACAACATCAAACTCTATGTCCGCCGTGTGTTCATCATGGACAGCTGTGATGAGTTGATACCAGAGTATCTCAATTTTATCCGTGGTGTGGTTGACTCTGAGGATCTGCCCCTGAACATCTCCCGAGAAATGCTCCAGCAGAGCAAAATCTTGAAAGTCATTCGCAAAAACATTGTTAAGAAGTGCCTTGAGCTCTTCTCTGAGCTGGCAGAAGACAAGGAGAATTACAAGAAATTCTATGAGGCATTCTCTAAAAATCTCAAGCTTGGAATCCACGAAGACTCCACTAACCGCCGCCGCCTGTCTGAGCTGCTGCGCTATCATACCTCCCAGTCTGGAGATGAGATGACATCTCTGTCAGAGTATGTTTCTCGCATGAAGGAGACACAGAAGTCCATCTATTACATCACTGGTGAGAGCAAAGAGCAGGTGGCCAACTCAGCTTTTGTGGAGCGAGTGCGGAAACGGGGCTTCGAGGTGGTATATATGACCGAGCCCATTGACGAGTACTGTGTGCAGCAGCTCAAGGAATTTGATGGGAAGAGCCTGGTCTCAGTTACCAAGGAGGGTCTGGAGCTGCCTGAGGATGAGGAGGAGAAGAAGAAGATGGAAGAGAGCAAGGCAAAGTTTGAGAACCTCTGCAAGCTCATGAAAGAAATCTTAGATAAGAAGGTTGAGAAGGTGACAATCTCCAATAGACTTGTGTCTTCACCTTGCTGCATTGTGACCAGCACCTACGGCTGGACAGCCAATATGGAGCGGATCATGAAAGCCCAGGCACTTCGGGACAACTCCACCATGGGCTATATGATGGCCAAAAAGCACCTGGAGATCAACCCTGACCACCCCATTGTGGAGACGCTGCGGCAGAAGGCTGAGGCCGACAAGAATGATAAGGCAGTTAAGGACCTGGTGGTGCTGCTGTTTGAAACCGCCCTGCTATCTTCTGGCTTTTCCCTTGAGGATCCCCAGACCCACTCCAACCGCATCTATCGCATGATCAAGCTAGGTCTAGGTATTGATGAAGATGAAGTGGCAGCAGAGGAACCCAATGCTGCAGTTCCTGATGAGATCCCCCCTCTCGAGGGCGATGAGGATGCGTCTCGCATGGAAGAAGTCGATTAGGTTAGGAGTTCATAGTTGGAAAACTTGTGCCCTTGTATAGTGTCCCCATGGGCTCCCACTGCAGCCTCGAGTGCCCCTGTCCCACCTGGCTCCCCCTGCTGGTGTCTAGTGTTTTTTTCCCTCTCCTGTCCTTGTGTTGAAGGCAGTAAACTAAGGGTGTCAAGCCCCATTCCCTCTCTACTCTTGACAGCAGGATTGGATGTTGTGTATTGTGGTTTATTTTATTTTCTTCATTTTGTTCTGAAATTAAAGTATGCAAAATAAAGAATATGCCGTTTTTATACA