Transcript asmbl_147896

Sequence
Transcript Sequence for observation asmbl_147896 of TGE0058547:
TCCTCTATAACTACCTGGATAAAAACCTGACTGTGAGGCCCCATAGGAGCCTGAGCATACAGGAGTTGGGGGAGCCAGGGCCCAGTGAGGGGTGGGGAGGCTAACCGGGCCAGGACTCTGGCCATCCTCGTTTTCCTGCCCTCAGGTGAGCGTCCACGTGTCCCCAGTGGAGGGGCTGTGCCTGGCTGGGGGCGGAGGGCTGGCCCAGCAGGTGCTGGTGCCTGCGGGCTCTGCCCGGCCTGTTGCCTTCTCTGTGGTGCCCACGGCAGCCGCCGCTGTGTCTCTGAAGGTGGTGGCTCGAGGGTCCTTCGAATTCCCTGTGGGAGATGCGGTGTCCAAGGTTCTGCAGATTGAGAAGGAAGGGGCCATCCATAGAGAGGAGCTGGTCTATGAACTCAACCCCTTGGACCACCGAGGCCGGACCTTGGAAATACCTGGCAACTCTGATCCCAATATGATCCCTGATGGGGACTTTAACAGCTACGTCAGGGTTACAGCCTCAGATCCATTGGACACTTTAGGCTCTGAGGGGGCCTTGTCACCAGGAGGCGTGGCCTCCCTCTTGAGGCTTCCTCGAGGCTGTGGGGAGCAAACCATGATCTACTTGGCTCCGACACTGGCTGCTTCCCGCTACCTGGACAAGACAGAGCAGTGGAGCACACTGCCTCCCGAGACCAAGGACCACGCCGTGGATCTGATCCAGAAAGGCTACATGCGGATCCAGCAGTTTCGGAAGGCGGATGGTTCCTATGCGGCTTGGTTGTCACGGGACAGCAGCACCTGGCTCACAGCCTTTGTGTTGAAGGTCCTGAGTTTGGCCCAGGAGCAGGTAGGAGGCTCGCCTGAGAAACTGCAGGAGACATCTAACTGGCTTCTGTCCCAGCAGCAGGCTGACGGCTCGTTCCAGGACCCCTGTCCAGTGTTAGACAGGAGCATGCAGGGGGGTTTGGTGGGCAATGATGAGACTGTGGCACTCACAGCCTTTGTGACCATCGCCCTTCATCATGGGCTGGCCGTCTTCCAGGATGAGGGTGCAGAGCCATTGAAGCAGAGAGTGGAAGCCTCCATCTCAAAGGCAAACTCATTTTTGGGGGAGAAAGCAAGTGCTGGGCTCCTGGGTGCCCACGCAGCTGCCATCACGGCCTATGCCCTGACACTGACCAAGGCGCCTGTGGACCTGCTCGGTGTTGCCCACAACAACCTCATGGCAATGGCCCAGGAGACTGGAGATAACCTGTACTGGGGCTCAGTCACTGGTTCTCAGAGCAATGCCGTGTCGCCCACCCCGGCTCCTCGCAACCCATCCGACCCCATGCCCCAGGCCCCAGCCCTGTGGATTGAAACCACAGCCTACGCCCTGCTGCACCTCCTGCTTCACGAGGGCAAAGCAGAGATGGCAGACCAGGCTTCGGCCTGGCTCACCCGTCAGGGCAGCTTCCAAGGGGGATTCCGCAGTACCCAAGACACGGTGATTGCCCTGGATGCCCTGTCTGCCTACTGGATTGCCTCCCACACCACTGAGGAGAGGGGTCTCAATGTGACTCTCAGCTCCACAGGCCGGAATGGGTTCAAGTCCCACGCGCTGCAGCTGAACAACCGCCAGATTCGCGGCCTGGAGGAGGAGCTGCAGTTTTCCTTGGGCAGCAAGATCAATGTGAAGGTGGGAGGAAACAGCAAAGGAACCCTGAAGGTCCTTCGTACCTACAATGTCCTGGACATGAAGAACACGACCTGCCAGGACCTACAGATAGAAGTGACAGTCAAAGGCCACGTCGAGTACACGATGGAAGCAAACGAGGACTATGAGGACTATGAGTACGATGAGCTTCCAGCCAAGGATGACCCAGATGCCCCTCTGCAGCCCGTGACACCCCTGCAGCTGTTTGAGGGTCGGAGGAACCGCCGCAGGAGGGAGGCGCCCAAGGTGGTGGAGGAGCAGGAGTCCAGGGTGCACTACACCGTGTGCATCTGGCGGAACGGCAAGGTGGGGCTGTCTGGCATGGCCATCGCGGACGTCACCCTCCTGAGTGGATTCCACGCCCTGCGTGCTGACCTGGAGAAGCTGACCTCCCTCTCTGACCGTTACGTGAGTCACTTTGAGACCGAGGGGCCCCACGTCCTGCTGTATTTTGACTCGGTCCCCACCTCCCGGGAGTGCGTGGGCTTTGAGGCTGTGCAGGAAGTGCCGGTGGGGCTGGTGCAGCCGGCCAGCGCAACCCTGTACGACTACTACAACCCCGAGCGCAGATGTTCTGTGTTTTACGGGGCACCAAGTAAGAGCAGACTCTTGGCCACCTTGTGTTCTGCTGAAGTCTGCCAGTGTGCTGAGGGGAAGTGCCCTCGCCAGCGTCGCGCCCTGGAGCGGGGTCTGCAGGACGAGGATGGCTACAGGATGAAGTTTGCCTGCTACTACCCCCGTGTGGAGTACGGCTTCCAGGTTAAGGTTCTCCGAGAAGACAGCAGAGCTGCTTTCCGCCTCTTTGAGACCAAGATCACCCAAGTCCTGCACTTCACCAAGGATGTCAAGGCCGCTGCTAATCAGATGCGCAACTTCCTGGTTCGAGCCTCCTGCCGCCTTCGCTTGGAACCTGGGAAAGAATATTTGATCATGGGTCTGGATGGGGCCACCTATGACCTCGAGGGACACCCCCAGTACCTGCTGGACTCGAATAGCTGGATCGAGGAGATGCCCTCTGAACGCCTGTGCCGGAGCACCCGCCAGCGGGCAGCCTGTGCCCAGCTCAACGACTTCCTCCAGGAGTATGGCACTCAGGGGTGCCAGGTGTGAGGGCTGCCCTCCCACCTCCGCTGGGAGGAACCTGAACCTGGGAACCATGAAGCTGGAAGCACTGCTGTGTCCGCTTTCATGAACACAGCCTGGGACCAGGGCATATTAAAGGCTTTTGGCAGCAA