Transcript asmbl_147895

Sequence
Transcript Sequence for observation asmbl_147895 of TGE0058546:
GCCAGAAGGTAGCAGACAGACAGACGGATCTAACCTCTCTTGGATCCTCCAGCCATGAGGCTGCTCTGGGGGCTGATCTGGGCATCCAGCTTCTTCACCTTATCTCTGCAGAAGCCCAGGTTGCTCTTGTTCTCTCCTTCTGTGGTTCATCTGGGGGTCCCCCTATCGGTGGGGGTGCAGCTCCAGGATGTGCCCCGAGGACAGGTAGTGAAAGGATCAGTGTTCCTGAGAAACCCATCTCGTAATAATGTCCCCTGCTCCCCAAAGGTGGACTTCACCCTTAGCTCAGAAAGAGACTTCGCACTCCTCAGTCTCCAGGTGCCCTTGAAAGATGCGAAGAGCTGTGGCCTCCATCAACTCCTCAGAGGCCCTGAGGTCCAGCTGGTGGCCCATTCGCCATGGCTAAAGGACTCTCTGTCCAGAACGACAAACATCCAGGGTATCAACCTGCTCTTCTCCTCTCGCCGGGGGCACCTCTTTTTGCAGACGGACCAGCCCATTTACAACCCTGGCCAGCGGGTTCGGTACCGGGTCTTTGCTCTGGATCAGAAGATGCGCCCGAGCACTGACACCATCACAGTCATGGTGGAGAACTCTCACGGCCTCCGCGTGCGGAAGAAGGAGGTGTACATGCCCTCGTCCATCTTCCAGGATGACTTTGTGATCCCAGACATCTCAGAGCCAGGGACCTGGAAGATCTCAGCCCGATTCTCAGATGGCCTGGAATCCAACAGCAGCACCCAGTTTGAGGTGAAGAAATATGTCCTTCCCAACTTTGAGGTGAAGATCACCCCTGGAAAGCCCTACATCCTGACGGTGCCAGGCCATCTTGATGAAATGCAGTTAGACATCCAGGCCAGGTACATCTATGGGAAGCCAGTGCAGGGGGTGGCATATGTGCGCTTTGGGCTCCTAGATGAGGATGGTAAGAAGACTTTCTTTCGGGGGCTGGAGAGTCAGACCAAGCTGGTGAATGGACAGAGCCACATTTCCCTCTCAAAGGCAGAGTTCCAGGACGCCCTGGAGAAGCTGAATATGGGCATTACTGACCTCCAGGGGCTGCGCCTCTACGTTGCTGCAGCCATCATTGAGTCTCCAGGTGGGGAGATGGAGGAGGCAGAGCTCACATCCTGGTATTTTGTGTCATCTCCCTTCTCCTTGGATCTTAGCAAGACCAAGCGACACCTTGTGCCTGGGGCCCCCTTCCTGCTGCAGGCCTTGGTCCGTGAGATGTCAGGCTCCCCAGCTTCTGGCATTCCTGTCAAAGTTTCTGCCACGGTGTCTTCTCCTGGGTCTGTTCCTGAAGTCCAGGACATTCAGCAAAACACAGACGGGAGCGGCCAAGTCAGCATTCCAATAATTATCCCTCAGACCATCTCAGAGCTGCAGCTCTCAGTATCTGCAGGCTCCCCACATCCAGCGATAGCCAGGCTCACTGTGGCAGCCCCACCTTCAGGAGGCCCCGGGTTTCTGTCTATTGAGCGGCCGGATTCTCGACCTCCTCGTGTTGGGGACACTCTGAACCTGAACTTGCGAGCCGTGGGCAGTGGGGCCACCTTTTCTCATTACTACTACATGATCCTATCCCGAGGGCAGATCGTGTTCATGAATCGAGAGCCCAAGAGGACCCTGACCTCGGTCTCGGTGTTTGTGGACCATCACCTGGCACCCTCCTTCTACTTTGTGGCCTTCTACTACCATGGAGACCACCCAGTGGCCAACTCCCTGCGAGTGGATGTCCAGGCTGGGGCCTGCGAGGGCAAGCTGGAGCTCAGCGTGGACGGTGCCAAGCAGTACCGGAACGGGGAGTCCGTGAAGCTCCACTTAGAAACCGACTCCCTAGCCCTGGTGGCGCTGGGAGCCTTGGACACAGCTCTGTATGCTGCAGGCAGCAAGTCCCACAAGCCCCTCAACATGGGCAAGGTCTTTGAAGCTATGAACAGCTATGACCTCGGCTGTGGTCCTGGGGGTGGGGACAGTGCCCTTCAGGTGTTCCAGGCAGCGGGCCTGGCCTTTTCTGATGGAGACCAGTGGACCTTATCCAGAAAGAGACTAAGCTGTCCCAAGGAGAAGACAACCCGGAAAAAGAGAAACGTGAACTTCCAAAAGGCGATTAATGAGAAATTGGGTCAGTATGCTTCCCCGACAGCCAAGCGCTGCTGCCAGGATGGGGTGACACGTCTGCCCATGATGCGTTCCTGCGAGCAGCGGGCAGCCCGCGTGCAGCAGCCGGACTGCCGGGAGCCCTTCCTGTCCTGCTGCCAATTTGCTGAGAGTCTGCGCAAGAAGAGCAGGGACAAGGGCCAGGCGGGCCTCCAACGAGCCCTGGAGATCCTGCAGGAGGAGGACCTGATTGATGAGGATGACATTCCCGTGCGCAGCTTCTTCCCAGAGAACTGGCTCTGGAGAGTGGAAACAGTGGACCGCTTTCAAATATTGACACTGTGGCTCCCCGACTCTCTGACCACGTGGGAGATCCATGGCCTGAGCCTGTCCAAAACCAAAGGCCTATGTGTGGCCACCCCAGTCCAGCTCCGGGTGTTCCGCGAGTTCCACCTGCACCTCCGCCTGCCCATGTCTGTCCGCCGCTTTGAGCAGCTGGAGCTGCGGCCTGTCCTCTATAACTACCTGGATAAAAACCTGACTGTGAGCGTCCACGTGTCCCCAGTGGAGGGGCTGTGCCTGGCTGGGGGCGGAGGGCTGGCCCAGCAGGTGCTGGTGCCTGCGGGCTCTGCCCGGCCTGTTGCCTTCTCTGTGGTGCCCACGGCAGCCGCCGCTGTGTCTCTGAAGGTGGTGGCTCGAGGGTCCTTCGAATTCCCTGTGGGAGATGCGGTGTCCAAGGTTCTGCAGATTGAGAAGGAAGGGGCCATCCATAGAGAGGAGCTGGTCTATGAACTCAACCCCTTGGACCACCGAGGCCGGACCTTGGAAATACCTGGCAACTCTGATCCCAATATGATCCCTGATGGGGACTTTAACAGCTACGTCAGGGTTACAGCCTCAGATCCATTGGACACTTTAGGCTCTGAGGGGGCCTTGTCACCAGGAGGCGTGGCCTCCCTCTTGAGGCTTCCTCGAGGCTGTGGGGAGCAAACCATGATCTACTTGGCTCCGACACTGGCTGCTTCCCGCTACCTGGACAAGACAGAGCAGTGGAGCACACTGCCTCCCGAGACCAAGGACCACGCCGTGGATCTGATCCAGAAAGGCTACATGCGGATCCAGCAGTTTCGGAAGGCGGATGGTTCCTATGCGGCTTGGTTGTCACGGGACAGCAGCACCTGGCTCACAGCCTTTGTGTTGAAGGTCCTGAGTTTGGCCCAGGAGCAGGTAGGAGGCTCGCCTGAGAAACTGCAGGAGACATCTAACTGGCTTCTGTCCCAGCAGCAGGCTGACGGCTCGTTCCAGGACCCCTGTCCAGTGTTAGACAGGAGCATGCAGGGGGGTTTGGTGGGCAATGATGAGACTGTGGCACTCACAGCCTTTGTGACCATCGCCCTTCATCATGGGCTGGCCGTCTTCCAGGATGAGGGTGCAGAGCCATTGAAGCAGAGAGTGGAAGCCTCCATCTCAAAGGCAAACTCATTTTTGGGGGAGAAAGCAAGTGCTGGGCTCCTGGGTGCCCACGCAGCTGCCATCACGGCCTATGCCCTGACACTGACCAAGGCGCCTGTGGACCTGCTCGGTGTTGCCCACAACAACCTCATGGCAATGGCCCAGGAGACTGGAGATAACCTGTACTGGGGCTCAGTCACTGGTTCTCAGAGCAATGCCGTGTCGCCCACCCCGGCTCCTCGCAACCCATCCGACCCCATGCCCCAGGCCCCAGCCCTGTGGATTGAAACCACAGCCTACGCCCTGCTGCACCTCCTGCTTCACGAGGGCAAAGCAGAGATGGCAGACCAGGCTTCGGCCTGGCTCACCCGTCAGGGCAGCTTCCAAGGGGGATTCCGCAGTACCCAAGACACGGTGATTGCCCTGGATGCCCTGTCTGCCTACTGGATTGCCTCCCACACCACTGAGGAGAGGGGTCTCAATGTGACTCTCAGCTCCACAGGCCGGAATGGGTTCAAGTCCCACGCGCTGCAGCTGAACAACCGCCAGATTCGCGGCCTGGAGGAGGAGCTGCAGTTTTCCTTGGGCAGCAAGATCAATGTGAAGGTGGGAGGAAACAGCAAAGGAACCCTGAAGGTCCTTCGTACCTACAATGTCCTGGACATGAAGAACACGACCTGCCAGGACCTACAGATAGAAGTGACAGTCAAAGGCCACGTCGAGTACACGATGGAAGCAAACGAGGACTATGAGGACTATGAGTACGATGAGCTTCCAGCCAAGGATGACCCAGATGCCCCTCTGCAGCCCGTGACACCCCTGCAGCTGTTTGAGGGTCGGAGGAACCGCCGCAGGAGGGAGGCGCCCAAGGTGGTGGAGGAGCAGGAGTCCAGGGTGCACTACACCGTGTGCATCTGGCGGAACGGCAAGGTGGGGCTGTCTGGCATGGCCATCGCGGACGTCACCCTCCTGAGTGGATTCCACGCCCTGCGTGCTGACCTGGAGAAGCTGACCTCCCTCTCTGACCGTTACGTGAGTCACTTTGAGACCGAGGGGCCCCACGTCCTGCTGTATTTTGACTCGGTCCCCACCTCCCGGGAGTGCGTGGGCTTTGAGGCTGTGCAGGAAGTGCCGGTGGGGCTGGTGCAGCCGGCCAGCGCAACCCTGTACGACTACTACAACCCCGAGCGCAGATGTTCTGTGTTTTACGGGGCACCAAGTAAGAGCAGACTCTTGGCCACCTTGTGTTCTGCTGAAGTCTGCCAGTGTGCTGAGGGGAAGTGCCCTCGCCAGCGTCGCGCCCTGGAGCGGGGTCTGCAGGACGAGGATGGCTACAGGATGAAGTTTGCCTGCTACTACCCCCGTGTGGAGTACGGCTTCCAGGTTAAGGTTCTCCGAGAAGACAGCAGAGCTGCTTTCCGCCTCTTTGAGACCAAGATCACCCAAGTCCTGCACTTCACCAAGGATGTCAAGGCCGCTGCTAATCAGATGCGCAACTTCCTGGTTCGAGCCTCCTGCCGCCTTCGCTTGGAACCTGGGAAAGAATATTTGATCATGGGTCTGGATGGGGCCACCTATGACCTCGAGGGACACCCCCAGTACCTGCTGGACTCGAATAGCTGGATCGAGGAGATGCCCTCTGAACGCCTGTGCCGGAGCACCCGCCAGCGGGCAGCCTGTGCCCAGCTCAACGACTTCCTCCAGGAGTATGGCACTCAGGGGTGCCAGGTGTGAGGGCTGCCCTCCCACCTCCGCTGGGAGGAACCTGAACCTGGGAACCATGAAGCTGGAAGCACTGCTGTGTCCGCTTTCATGAACACAGCCTGGGACCAGGGCATATTAAAGGCTTTTGGCAGCAA