Transcript asmbl_147894

Sequence
Transcript Sequence for observation asmbl_147894 of TGE0058545:
GCCAGAAGGTAGCAGACAGACAGACGGATCTAACCTCTCTTGGATCCTCCAGCCATGAGGCTGCTCTGGGGGCTGATCTGGGCATCCAGCTTCTTCACCTTATCTCTGCAGAAGCCCAGGTTGCTCTTGTTCTCTCCTTCTGTGGTTCATCTGGGGGTCCCCCTATCGGTGGGGGTGCAGCTCCAGGATGTGCCCCGAGGACAGGTAGTGAAAGGATCAGTGTTCCTGAGAAACCCATCTCGTAATAATGTCCCCTGCTCCCCAAAGGTGGACTTCACCCTTAGCTCAGAAAGAGACTTCGCACTCCTCAGTCTCCAGGTGCCCTTGAAAGATGCGAAGAGCTGTGGCCTCCATCAACTCCTCAGAGGCCCTGAGGTCCAGCTGGTGGCCCATTCGCCATGGCTAAAGGACTCTCTGTCCAGAACGACAAACATCCAGGGTATCAACCTGCTCTTCTCCTCTCGCCGGGGGCACCTCTTTTTGCAGACGGACCAGCCCATTTACAACCCTGGCCAGCGGGTTCGGTACCGGGTCTTTGCTCTGGATCAGAAGATGCGCCCGAGCACTGACACCATCACAGTCATGGTGGAGAACTCTCACGGCCTCCGCGTGCGGAAGAAGGAGGTGTACATGCCCTCGTCCATCTTCCAGGATGACTTTGTGATCCCAGACATCTCAGAGCCAGGGACCTGGAAGATCTCAGCCCGATTCTCAGATGGCCTGGAATCCAACAGCAGCACCCAGTTTGAGGTGAAGAAATATGTCCTTCCCAACTTTGAGGTGAAGATCACCCCTGGAAAGCCCTACATCCTGACGGTGCCAGGCCATCTTGATGAAATGCAGTTAGACATCCAGGCCAGGTACATCTATGGGAAGCCAGTGCAGGGGGTGGCATATGTGCGCTTTGGGCTCCTAGATGAGGATGGTAAGAAGACTTTCTTTCGGGGGCTGGAGAGTCAGACCAAGCTGGTGAATGGACAGAGCCACATTTCCCTCTCAAAGGCAGAGTTCCAGGACGCCCTGGAGAAGCTGAATATGGGCATTACTGACCTCCAGGGGCTGCGCCTCTACGTTGCTGCAGCCATCATTGAGTCTCCAGGTGGGGAGATGGAGGAGGCAGAGCTCACATCCTGGTATTTTGTGTCATCTCCCTTCTCCTTGGATCTTAGCAAGACCAAGCGACACCTTGTGCCTGGGGCCCCCTTCCTGCTGCAGGCCTTGGTCCGTGAGATGTCAGGCTCCCCAGCTTCTGGCATTCCTGTCAAAGTTTCTGCCACGGTGTCTTCTCCTGGGTCTGTTCCTGAAGTCCAGGACATTCAGCAAAACACAGACGGGAGCGGCCAAGTCAGCATTCCAATAATTATCCCTCAGACCATCTCAGAGCTGCAGCTCTCAGTATCTGCAGGCTCCCCACATCCAGCGATAGCCAGGCTCACTGTGGCAGCCCCACCTTCAGGAGGCCCCGGGTTTCTGTCTATTGAGCGGCCGGATTCTCGACCTCCTCGTGTTGGGGACACTCTGAACCTGAACTTGCGAGCCGTGGGCAGTGGGGCCACCTTTTCTCATTACTACTACATGATCCTATCCCGAGGGCAGATCGTGTTCATGAATCGAGAGCCCAAGAGGACCCTGACCTCGGTCTCGGTGTTTGTGGACCATCACCTGGCACCCTCCTTCTACTTTGTGGCCTTCTACTACCATGGAGACCACCCAGTGGCCAACTCCCTGCGAGTGGATGTCCAGGCTGGGGCCTGCGAGGGCAAGCTGGAGCTCAGCGTGGACGGTGCCAAGCAGTACCGGAACGGGGAGTCCGTGAAGCTCCACTTAGAAACCGACTCCCTAGCCCTGGTGGCGCTGGGAGCCTTGGACACAGCTCTGTATGCTGCAGGCAGCAAGTCCCACAAGCCCCTCAACATGGGCAAGGTCTTTGAAGCTATGAACAGCTATGACCTCGGCTGTGGTCCTGGGGGTGGGGACAGTGCCCTTCAGGTGTTCCAGGCAGCGGGCCTGGCCTTTTCTGATGGAGACCAGTGGACCTTATCCAGAAAGAGACTAAGCTGTCCCAAGGAGAAGACAACCCGGAAAAAGAGAAACGTGAACTTCCAAAAGGCGATTAATGAGAAATTGGGTCAGTATGCTTCCCCGACAGCCAAGCGCTGCTGCCAGGATGGGGTGACACGTCTGCCCATGATGCGTTCCTGCGAGCAGCGGGCAGCCCGCGTGCAGCAGCCGGACTGCCGGGAGCCCTTCCTGTCCTGCTGCCAATTTGCTGAGAGTCTGCGCAAGAAGAGCAGGGACAAGGGCCAGGCGGGCCTCCAACGAGCCCTGGAGATCCTGCAGGAGGAGGACCTGATTGATGAGGATGACATTCCCGTGCGCAGCTTCTTCCCAGAGAACTGGCTCTGGAGAGTGGAAACAGTGGACCGCTTTCAAATATTGACACTGTGGCTCCCCGACTCTCTGACCACGTGGGAGATCCATGGCCTGAGCCTGTCCAAAACCAAAGGCCTATGTGTGGCCACCCCAGTCCAGCTCCGGGTGTTCCGCGAGTTCCACCTGCACCTCCGCCTGCCCATGTCTGTCCGCCGCTTTGAGCAGCTGGAGCTGCGGCCTGTCCTCTATAACTACCTGGATAAAAACCTGACTGTGAGCGTCCACGTGTCCCCAGTGGAGGGGCTGTGCCTGGCTGGGGGCGGAGGGCTGGCCCAGCAGGTGCTGGTGCCTGCGGGCTCTGCCCGGCCTGTTGCCTTCTCTGTGGTGCCCACGGCAGCCGCCGCTGTGTCTCTGAAGGTGGTGGCTCGAGGGTCCTTCGAATTCCCTGTGGGAGATGCGGTGTCCAAGGTTCTGCAGATTGAGAAGGAAGGGGCCATCCATAGAGAGGAGCTGGTCTATGAACTCAACCCCTTGGACCACCGAGGCCGGACCTTGGAAATACCTGGCAACTCTGATCCCAATATGATCCCTGATGGGGACTTTAACAGCTACGTCAGGGTTACAGCCTCAGATCCATTGGACACTTTAGGCTCTGAGGGGGCCTTGTCACCAGGAGGCGTGGCCTCCCTCTTGAGGCTTCCTCGAGGCTGTGGGGAGCAAACCATGATCTACTTGGCTCCGACACTGGCTGCTTCCCGCTACCTGGACAAGACAGAGCAGTGGAGCACACTGCCTCCCGAGACCAAGGACCACGCCGTGGATCTGATCCAGAAAGGCTACATGCGGATCCAGCAGTTTCGGAAGGCGGATGGTTCCTATGCGGCTTGGTTGTCACGGGACAGCAGCACCTGGCTCACAGCCTTTGTGTTGAAGGTCCTGAGTTTGGCCCAGGAGCAGGTAGGAGGCTCGCCTGAGAAACTGCAGGAGACATCTAACTGGCTTCTGTCCCAGCAGCAGGCTGACGGCTCGTTCCAGGACCCCTGTCCAGTGTTAGACAGGAGCATGCAGGGGGGTTTGGTGGGCAATGATGAGACTGTGGCACTCACAGCCTTTGTGACCATCGCCCTTCATCATGGGCTGGCCGTCTTCCAGGATGAGGGTGCAGAGCCATTGAAGCAGAGAGTGGAAGCCTCCATCTCAAAGGCAAACTCATTTTTGGGGGAGAAAGCAAGTGCTGGGCTCCTGGGTGCCCACGCAGCTGCCATCACGGCCTATGCCCTGACACTGACCAAGGCGCCTGTGGACCTGCTCGGTGTTGCCCACAACAACCTCATGGCAATGGCCCAGGAGACTGGAGATAACCTGTACTGGGGCTCAGTCACTGGTTCTCAGAGCAATGCCGTGTCGCCCACCCCGGCTCCTCGCAACCCATCCGACCCCATGCCCCAGGCCCCAGCCCTGTGGATTGAAACCACAGCCTACGCCCTGCTGCACCTCCTGCTTCACGAGGGCAAAGCAGAGATGGCAGACCAGGCTTCGGCCTGGCTCACCCGTCAGGGCAGCTTCCAAGGGGGATTCCGCAGTACCCAAGACACGGTGATTGCCCTGGATGCCCTGTCTGCCTACTGGATTGCCTCCCACACCACTGAGGAGAGGGGTCTCAATGTGACTCTCAGCTCCACAGGCCGGAATGGGTTCAAGTCCCACGCGCTGCAGCTGAACAACCGCCAGATTCGCGGCCTGGAGGAGGAGCTGCAGTTTTCCTTGGGCAGCAAGATCAATGTGAAGGTGGGAGGAAACAGCAAAGGAACCCTGAAGGTCCTTCGTACCTACAATGTCCTGGACATGAAGAACACGACCTGCCAGGACCTACAGATAGAAGTGACAGTCAAAGGCCACGTCGAGTACACGATGGAAGCAAACGAGGACTATGAGGACTATGAGTACGATGAGCTTCCAGCCAAGGATGACCCAGATGCCCCTCTGCAGCCCGTGACACCCCTGCAGCTGTTTGAGGGTCGGAGGAACCGCCGCAGGAGGGAGGCGCCCAAGGTGGTGGAGGAGCAGGAGTCCAGGGTGCACTACACCGTGTGCATCTGGCGGAACGGCAAGGTGGGGCTGTCTGGCATGGCCATCGCGGACGTCACCCTCCTGAGTGGATTCCACGCCCTGCGTGCTGACCTGGAGAAGCTGACCTCCCTCTCTGACCGTTACGTGAGTCACTTTGAGACCGAGGGGCCCCACGTCCTGCTGTATTTTGACTCGGTGAGTGGGGAGAGATGAGGCAGGAAGGGACTCGATGGCACCGGGTTTACTGAGTATGCGTTAGGAGGTTTCTCAGGAGACAGCTGTGTCAGCGGCTGGTGCTCTTGAGAACTTGTGATGTCATCAGAGAGAAGGACAAGAATGTGAGCCCGTGAGACACAGCAGAGTAAGGGGCAGACCTGCAGGCGGCAGGGACC