Transcript asmbl_147880

Sequence
Transcript Sequence for observation asmbl_147880 of TGE0058090:
GCTGGATCCTTATTTCTGGTCCCTAAGTGGGTGGTTTGGGCTTACTGGGGAGGAGCTAAGGCCGGAGAGGAGGTACTGAAGGGGAGAGTCCTGGACCTTTGGCAGCAAAGGGTGGGACTTCTGCAGTTTCTGTTTCCTTGACTGGCAGCTCAGCGGGGCCCTCCCGCTTGGATGTTCCGGGAAAGTGATGTGGGTAGGACAGGCGGGGCGAGCCGCAGGTGCCAGAACACAGATTGTATAAAAGGCTGGGGGCTGGTGGGGAGCAGGGGAAGGGAATGTGACCAGGTCTAGGTCTGGAGTTTCAGCTTGGACACTGAGCCAAGCAGACAAGCAAAGCAAGCCAGGACACACCATCCTGCCCCAGGCCCAGCTTCTCTCCTGCCTTCCAACGCCATGGGGAGCAATCTCAGCCCCCAACTCTGCCTGATGCCCTTTATCTTGGGCCTCTTGTCTGGAGGTGTGACCACCACTCCATGGTCTTTGGCCCGGCCCCAGGGATCCTGCTCTCTGGAGGGGGTAGAGATCAAAGGCGGCTCCTTCCGACTTCTCCAAGAGGGCCAGGCACTGGAGTACGTGTGTCCTTCTGGCTTCTACCCGTACCCTGTGCAGACACGTACCTGCAGATCTACGGGGTCCTGGAGCACCCTGAAGACTCAAGACCAAAAGACTGTCAGGAAGGCAGAGTGCAGAGCAATCCACTGTCCAAGACCACACGACTTCGAGAACGGGGAATACTGGCCCCGGTCTCCCTACTACAATGTGAGTGATGAGATCTCTTTCCACTGCTATGACGGTTACACTCTCCGGGGCTCTGCCAATCGCACCTGCCAAGTGAATGGCCGATGGAGTGGGCAGACAGCGATCTGTGACAACGGAGCGGGGTACTGCTCCAACCCGGGCATCCCCATTGGCACAAGGAAGGTGGGCAGCCAGTACCGCCTTGAAGACAGCGTCACCTACCACTGCAGCCGGGGGCTTACCCTGCGTGGCTCCCAGCGGCGAACGTGTCAGGAAGGTGGCTCTTGGAGCGGGACGGAGCCTTCCTGCCAAGACTCCTTCATGTACGACACCCCTCAAGAGGTGGCCGAAGCTTTCCTGTCTTCCCTGACAGAGACCATAGAAGGAGTCGATGCTGAGGATGGGCACGGCCCAGGGGAACAACAGAAGCGGAAGATCGTCCTGGACCCTTCAGGCTCCATGAACATCTACCTGGTGCTAGATGGATCAGACAGCATTGGGGCCAGCAACTTCACAGGAGCCAAAAAGTGTCTAGTCAACTTAATTGAGAAGGTGGCAAGTTATGGTGTGAAGCCAAGATATGGTCTAGTGACATATGCCACATACCCCAAAATTTGGGTCAAAGTGTCTGAAGCAGACAGCAGTAATGCAGACTGGGTCACGAAGCAGCTCAATGAAATCAATTATGAAGACCACAAGTTGAAGTCAGGGACTAACACCAAGAAGGCCCTCCAGGCAGTGTACAGCATGATGAGCTGGCCAGATGACGTCCCTCCTGAAGGCTGGAACCGCACCCGCCATGTCATCATCCTCATGACTGATGGATTGCACAACATGGGCGGGGACCCAATTACTGTCATTGATGAGATCCGGGACTTGCTATACATTGGCAAGGATCGCAAAAACCCAAGGGAGGATTATCTGGATGTCTATGTGTTTGGGGTCGGGCCTTTGGTGAACCAAGTGAACATCAATGCTTTGGCTTCCAAGAAAGACAATGAGCAACATGTGTTCAAAGTCAAGGATATGGAAAACCTGGAAGATGTTTTCTACCAAATGATCGATGAAAGCCAGTCTCTGAGTCTCTGTGGCATGGTTTGGGAACACAGGAAGGGTACCGATTACCACAAGCAACCATGGCAGGCCAAGATCTCAGTCATTCGCCCTTCAAAGGGACACGAGAGCTGTATGGGGGCTGTGGTGTCTGAGTACTTTGTGCTGACAGCAGCACATTGTTTCACTGTGGATGACAAGGAACACTCAATCAAGGTCAGCGTAGGAGGGGAGAAGCGGGACCTGGAGATAGAAGTAGTCCTATTTCACCCCAACTACAACATTAATGGGAAAAAAGAAGCAGGAATTCCTGAATTTTATGACTATGACGTTGCCCTGATCAAGCTCAAGAATAAGCTGAAATATGGCCAGACTATCAGGCCCATTTGTCTCCCCTGCACCGAGGGAACAACTCGAGCTTTGAGGCTTCCTCCAACTACCACTTGCCAGCAACAAAGTAAGACATACTTGGCAAGAGGATAAGGATGAGATCCCAAGAGACAAGTGGGGCATGAGAGGGAGGTGCAATAGGAAGAGATGATGCCTGGCCCAGAACCTAGCTCTAGAAGGGCTTAGGGGACATCTACTGAGTGACAAAGGCAATGGGGAGATGACAGTGGTGGGAGCAGCTGAAGTGACGCAGTCTATTCGTCCAGAGGAAGAGCTGCTCCCTGCACAGGATATCAAAGCTCTGTTTGTGTCTGAGGAGGAGAAAAAGCTGACTCGGAAGGAGGTCTACATCAAGAATGGGGATAAGAAAGGCAGCTGTGAGAGAGATGCTCAATATGCCCCAGGCTATGACAAAGTCAAGGACATCTCAGAGGTGGTCACCCCTCGGTTCCTTTGTACTGGAGGAGTGAGTCCCTATGCTGACCCCAATACTTGCAGAGGTGATTCTGGCGGCCCCTTGATAGTTCACAAGAGAAGTCGTTTCATTCAAGTTGGTGTAATCAGCTGGGGAGTAGTGGATGTCTGCAAAAACCAGAAGCGGCAAAAGCAGGTACCTGCTCACGCCCGAGACTTTCACATCAACCTCTTTCAAGTGCTGCCCTGGCTGAAGGAGAAACTCCAAGATGAGGATTTGGGTTTTCTATAAGGGGTTTCCTGCTGGACAGGGGCGTGGGATTGAATTAAAACAGCTGCGACAACA