Transcript asmbl_14646

Sequence
Transcript Sequence for observation asmbl_14646 of TGE0058540:
CTCCCCTATTTCCCGGGGTGGGAACGCCGGGAGGCGGGAGGAGAGGGGGCTGCCAGGGGCGTCCGGTTACATCCCCGCCTTCCTCTGTCCTGGCCGCGGGACCGGGTTTGCGGGACCGCAGTTCGGGAACATGTTGGCCTCGAGCAGCCGGATCCGGGCTGCGTGGACGCGGGCGCTGCTGCTGCCGCTGCTGCTGGCGGGGCCTGTGGGCTGCCTGAGCCGCCAGGAGCTCTTTCCCTTCGGCCCCGGACAGGGGGACCTGGAGCTGGAGGACGGGGATGACTTCGTCTCTCCTGCCCTGGAGCTGAGTGGGGCGCTCCGCTTCTACGACAGATCCGACATCGACGCAGTCTACGTCACCACAAATGGCATCATTGCTACGAGTGAACCCCCGGCCAAAGAATCCCATCCCGGGCTCTTCCCACCAACATTCGGTGCAGTCGCCCCTTTCCTGGCGGACTTGGACACGACCGATGGCCTGGGGAAGGTTTATTATCGAGAAGACTTATCCCCCTCCATCACTCAGCGAGCAGCAGAGTGTGTCCACAGAGGGTTCCCGGAGATCTCTTTCCAGCCTAGTAGCGCGGTGGTTGTCACTTGGGAATCCGTGGCCCCCTACCAAGGGCCCAGCAGGGACCCAGACCAGAAAGGCAAGAGAAACACGTTCCAGGCTGTTCTAGCCTCCTCTGATTCCAGCTCCTATGCCATTTTCCTTTATCCTGAGGATGGTCTGCAGTTCCATACGACATTCTCAAAGAAGGAAAACAACCAAGTTCCTGCCGTGGTTGCATTCAGTCAAGGTTCAGTGGGATTCTTATGGAAGAGCAACGGAGCTTATAACATATTTGCTAATGACAGGGAATCAGTTGAAAATTTGGCCAAGAGTAGTAACTCTGGGCAGCAGGGTGTCTGGGTGTTTGAGATTGGGAGTCCAGCCACCACCAATGGCGTGGTGCCTGCAGACGTGATCCTCGGAACTGAAGATGGGGCAGAGTATGATGATGAGGATGAAGATTATGACCTGGCGACCACTCGTCTGGGCCTGGAGGATGTGGGCACCACGCCCTTCTCCTACAAGGCTCTGAGAAGGGGAGGTGCTGACACATACAGTGTGCCCAGCGTCCTCTCCCCGCGCCGGGCAGCTACCGAAAGGCCCCTTGGACCTCCCACAGAGAGAACCAGGTCTTTCCAGTTGGCAGTGGAGACTTTTCACCAGCAGCACCCTCAGGTCATAGATGTGGATGAAGTTGAGGAAACAGGAGTTGTTTTCAGCTATAACACGGATTCCCGCCAGACGTGTGCTAACAACAGACACCAGTGCTCGGTGCACGCAGAGTGCAGGGACTACGCCACGGGCTTCTGCTGCAGCTGTGTCGCTGGCTATACGGGCAATGGCAGGCAATGTGTTGCAGAAGGTTCCCCCCAGCGAGTCAATGGCAAGGTGAAAGGAAGGATCTTTGTGGGGAGCAGCCAGGTCCCCATTGTCTTTGAGAACACTGACCTCCACTCTTACGTAGTAATGAACCACGGGCGCTCCTACACAGCCATCAGCACCATTCCCGAGACCGTTGGATATTCTCTGCTTCCACTGGCCCCAGTTGGAGGCATCATTGGATGGATGTTTGCAGTGGAGCAGGACGGATTCAAGAATGGGTTCAGCATCACCGGGGGTGAGTTCACTCGCCAGGCTGAGGTGACCTTCGTGGGGCACCCGGGCAATCTGGTCATTAAGCAGCGGTTCAGCGGCATCGATGAGCATGGGCACCTGACCATCGACACGGAGCTGGAGGGCCGCGTGCCGCAGATTCCGTTCGGCTCCTCCGTGCACATTGAGCCCTACACGGAGCTGTACCACTACTCCACCTCAGTGATCACTTCCTCCTCCACCCGGGAGTACACGGTGACTGAGCCCGAGCGAGATGGGGCATCTCCTTCACGCATCTACACTTACCAGTGGCGCCAGACCATCACCTTCCAGGAATGCGTCCACGATGACTCCCGGCCAGCCCTGCCCAGCACCCAGCAGCTCTCGGTGGACAGCGTGTTCGTCCTGTACAACCAGGAGGAGAAGATCTTGCGCTATGCTCTCAGCAACTCCATTGGGCCTGTGAGGGAAGGCTCCCCTGATGCTCTTCAGAATCCCTGCTACATCGGCACTCATGGGTGTGACACCAACGCGGCCTGTCGCCCTGGTCCCAGGACACAGTTCACCTGCGAGTGCTCCATCGGCTTCCGAGGAGACGGGCGAACCTGCTATGATATTGATGAATGTTCAGAACAACCCTCAGTGTGTGGGAGCCACACAATCTGCAATAATCACCCAGGAACCTTCCGCTGCGAGTGTGTGGAGGGCTACCAGTTTTCAGATGAGGGAACGTGTGTGGCTGTCGTGGACCAGCGCCCCATCAACTACTGTGAAACTGGCCTTCATAACTGCGACATACCCCAGCGGGCCCAGTGTATCTACACAGGAGGCTCCTCCTACACCTGTTCCTGCTTGCCAGGCTTTTCTGGGGATGGCCAAGCCTGCCAAGATGTAGATGAATGCCAGCCAAGCCGATGTCACCCTGACGCCTTCTGCTACAACACTCCAGGCTCTTTCACGTGCCAGTGCAAACCTGGTTATCAGGGAGACGGCTTCCGTTGCGTGCCCGGAGAGGTGGAGAAAACCCGGTGCCAGCACGAGCGAGAACACATTCTCGGGGCAGCGGGGGCGACAGACCCACAGCGACCCATTCCTCCGGGGCTGTTCGTTCCTGAGTGCGATGCGCACGGGCACTACGCGCCCACCCAGTGCCACGGCAGCACCGGCTACTGCTGGTGCGTGGATCGCGACGGCCGCGAGGTGGAGGGCACCAGGACCAGGCCCGGGATGACGCCCCCGTGTCTGAGTACAGTGGCTCCCCCGATTCACCAAGGACCTGCGGTGCCTACCGCCGTGATCCCCTTGCCTCCTGGGACCCATTTACTCTTTGCCCAGACTGGGAAGATTGAGCGCCTGCCCCTGGAGGGAAATACCATGAGGAAGACAGAAGCAAAGGCGTTCCTTCATGTCCCGGCTAAAGTCATCATTGGACTGGCCTTTGACTGCGTGGACAAGATGGTTTACTGGACGGACATCACTGAGCCTTCCATTGGGAGAGCTAGTCTACATGGTGGAGAGCCAACCACCATCATTAGACAAGATCTTGGAAGTCCAGAAGGTATCGCTGTTGATCACCTTGGCCGCAACATCTTCTGGACAGACTCTAACCTGGATCGAATAGAAGTGGCGAAGCTGGACGGCACGCAGCGCCGGGTGCTCTTTGAGACTGACTTGGTGAATCCCAGAGGCATTGTAACGGATTCCGTGAGAGGGAACCTTTACTGGACAGACTGGAACAGAGATAACCCCAAGATTGAAACTTCCTACATGGACGGCACGAACCGGAGGATCCTTGTGCAGGATGACCTGGGCTTGCCCAATGGACTGACCTTCGATGCGTTCTCATCTCAGCTCTGCTGGGTGGATGCAGGCACCAATCGGGCGGAATGCCTGAACCCCAGTCAGCCCAGCAGACGCAAGGCTCTCGAAGGGCTCCAGTATCCTTTTGCTGTGACGAGCTACGGGAAGAATCTGTATTTCACAGACTGGAAGATGAATTCCGTGGTTGCTCTCGATCTTGCAATTTCCAAGGAGACGGATGCTTTCCAACCCCACAAGCAGACCCGGCTGTATGGCATCACCACGGCCCTGTCTCAGTGTCCGCAAGGCCATAACTACTGCTCAGTGAACAATGGCGGCTGCACCCACCTATGCTTGGCCACCCCAGGGAGCAGGACCTGCCGTTGCCCTGACAACACCTTGGGAGTTGACTGTATCGAACAGAAATGAAGACAAGAGTGCCTTATTTCCTTTCCAAGTATTTCACAGCAACACTCTACTTGAAGCAACTTGGTCCAGATTGAAAAGTGTCCTCTGGCTGAGTGGCCACTAGGCCCAGACCCAGCCCAGCCTGAGCCCCAACAACTTTTCCCTCACTGTTCCCCAAAACATGCACCCTGGACTTCTCTAATAGAAAAGTCTCCACCCCTACACAAGGACAGAACCCTCCACCCCTACCCCCAACCCTCAGACAGACTTATACACCCCTGAGTGAGGATTACATGCCCATCCCAGTGTCCTAGGACCTTTTCCCAATACTAGCCCCCCAGTGGTGAACAGAACCTCCCAAATTTGAGTTGCACCCTTCCCTGTGGCCTTATGAGCTCAGCCTCGCTTTGAGGTACCCACCGTCCTGTCAGCTCCTTGACCTATGAGCCGGGGCCTGACTAGGAAAAGTTGGGAGTTAAGGAGGAAATTAGCATTCCTTAATGTTTTGTTTTGGTGCTCTGAATTTCTTCTTTATTATAGTCCTATAGTTTTACTCCTCAGTTCCTCACCATCATCATCTTGTCTAAGACCCCCATTATAATATTCATGCGCTGCTTTTTCATCAAAACCTACCCTGTCCTAGAGATCTATGGGCATTTGGTGGATGATAATGAGCAGCCCCTCCCAGATAGAATGTCAATATTTGAGCAGTAGGATATTGGCATTTGTTAGTTAAAGGCTTAAATCAAAAGAATGTCCAATGGTAGGAATTTCAAGGTGTAGGTCAGATATTTGAGAATAGGGGATTTTTTTGATGTGCCTTAAATTATACCAAAGATTACTAATTATTCCTCTTTGCCCAAAATACTTGCATCCAAGGTTCTAGTCTCTGTTGCTGTGCTGGTCTTTAGCCCCACTGCTTGCACTGATGTCCCTCCTTTTCACGGAGACCTATCTGAGGTACAGGATGGGGCTGGCACCAGATGATGTCCCACCACAGTCCCTCACCTCCGGCCTCCACATGACAGAACCAATTTACACTCAACCATGACCTCACCCCTCCTTGGTTTCTCCCTCGATCTGTGGCCCTTTTTGGATGTATTCTTATCTAACAACACAATCCGGAAAGACTGAATTGAATATTTATACTAATGGTTCATATCCTTTATTGCTCAATGATCTAATTAAAGGGATCATTGCCACATTTCATGTTTATATTTCTACAATTTGTTTAGAAAACATCTCCTGACCATATCAGTAGCTCGTGTTATCTTTTTATCAACTGCTTCCCAGAGTCCTAAAACAATAGAAATTTTGGATTGAAAAGTTCAGCATAAGGAGTTTGAGTCAGTAAAGGATGGGATAAAGGAGTCGAGATGATTCAATGAAAAGTATCACAAAAAAGAGATTGATCAACAAGAGAAATAAAAAAGCCCAAGAGGAAGTGGTAGGGGAAGGAATTTAAGAACAGCAATAAGTAAAACTCTTAAGTAACTCCAAAAAGAAAATGGTACATTTTGCCAAAGACCACTTATACTTGAGAACATGGAAGAATTTGCCTGATACTCTCTTTGGGGAAAAGAGTCTCTCCTCTTTTCCTCAAACCCCAGTACACTCAGCCTCTCTGCCCCACCTTCTCCTGACTTTGTCCTCACTTGCTTCTGCAGTACATTGGAACCTGAATTGAAAGAAAGTCTTCCTTGAATAATTGGAGTTTGTCTTGAGAGGCAAATATAGCCCCAAGAATCACAAGATTCGAGGACCATGTAGGTCTTTTACGTAGCCCAAATCCATAAATTAGTCTCACTTTTTGTATTTATCGTTTCATATTAAACCCTCTATATCAAATGTTCATCATGATTTTGTATGATTTTTATAACTATTTTATTCATTTTATTAGATTTATTCTAAAATTTTTTAATGGTAAATTCTTAAACTGTGGAAACCACTGAAGGTGCTTATTAACTGTTCTCCCAGATTTGTACAAGTATTGGATGATTCCTTGAGTTTACAGCTGTACAAATAGTGTGG