Transcript asmbl_142132

Sequence
Transcript Sequence for observation asmbl_142132 of TGE0058539:
TCACTTGAATTTTAAAGTTTATTTACTTTGAAGTAACCAACTTAAAAAATGGCCTGAGTTAAGTGTATTAAAAAGAAGAAATAGTCGTAAGATGGCAGTATAAATTCATCTCTGCATGTAGAAACCGGAAAAAAAGCAAGTTCAGTACTTCACCAAAAAATTTCAACATTGCAAACACAGGAAATTGAGAACTGACAAACAGAAATACTAGGAAATGCAAAGTCTTGAAGCTCCAAAACAAAAACAGCAATCTTGGAAAGGCCCCTAATCTACCTCCTCAATGGTGGGGCCTGACCCAGACCCTCCCTTGGGACCCTGAGCCCCGAAGCCCCCAGGCCCGGGACCACCGGCACCCTGGTACAGTCCGCTGATGATGGGGTTACACACCTGCTCCAGCTCCTTCCTCTTGTGCTCAAACTCGTCCTTCTCGGCCAAGGTGTTGGCGTCCAGCCACGAGATGACCTCTTGACACTTGTCCAGCACCTTCTTCTTGTCCGCCTCGCTGATCTTGCCCTTGAGCCCCTCATCCTCCACGGCGCTCTTCATGTTGAAGGCGTAGGACTCCAGGGCGTTCTTGGCTGACACCCTCTCGCGCTGCACCTCGTCCTCCGCTTTGTACTTCTCCGCCTCCTGCACCATGCGCTCGATCTCCTCCTTGCTCAGGCGGCCCTTGTCGTTGGTGATGGTGATCTTGTTGGCCTTGCCGGTGCTCTTGTCCGTGGCCGTGACGTTCAGGATGCCGTTGGCATCGATGTCGAAGGTCACCTCGATCTGGGGCACGCCCCTGGGGGCCGGAGGGATGCCGCTCAGCTCGAAGCGCCCCAACAGATTGTTGTCTTTCGTCATGGCCCTCTCGCCCTCGTACACCTGGATCAGCACCCCGGGTTGGTTGTCGGAGTAGGTGGTGAAGATCTGCGTCTGCTTGGTGGGGATGGTGGAGTTGCGCTTGATCAGGGCAGTCATCACGCCTCCGGCCGTCTCCAGCCCCAGCGACAGGGGAGCCACGTCCAGCAGCAGCAGGTCCTGCACGTTCTCGGACTTGTCCCCCATCAGGATGGCCGCCTGCACCGCCGCCCCGTAGGCCACAGCCTCGTCGGGGTTGATGCTCTTGTTCAGGTCGCGCCCGTTGAAGAAGTCCTGCAGCAGCTTCTGCACCTTGGGGATGCGGGTGGAGCCCCCGACCAGGACCAGGTCGTGAATCTGGGCCTTGTCCAGCTTGGCGTCGCGCAGAGCCTTCTCCACGGGCTCCAGGGTGCTTCGGAACAGGTCGGAGCACAGCTCCTCGAACCTCGCCCTGGTGATGGACGTGTAGAAGTCGATGCCCTCAAACAGGGAGTCGATCTCCAGGCTGGCCTGGGTGCTGGACGACAGGGTCCTCTTGGCCCTCTCGCAGGCGGTGCGCAGCCGCCTCACGGCTCGCTTGTTCTGGCTGATGTCCTTCTTGTGTTTTCTCTTGAACTCCTCCACGAAGTGGTTCACCAGCCTGTTGTCAAAGTCCTCCCCACCCAGGTGGGTGTCCCCGGCCGTGGCCTTCACCTCGAAGATGCCGTCGTCGATCGTCAGGATGGACACGTCGAAGGTGCCCCCGCCCAGGTCAAAGATGAGCACGTTGCGCTCCCCCTTGCCCGTTCTGTCCAGGCCGTAGGCGATGGCGGCGGCCGTGGGCTCGTTGATGATCCGCAGCACGTTGAGCCCCGCGATCACACCCGCATCCTTGGTGGCCTGGCGCTGCGAGTCGTTGAAGTAGGCCGGCACGGTGATCACCGCGTTGGTCACCGGGTAGCCCAGGTACGCCTCGGCGATCTCCTTCATCTTGGTCAGCACCATGGACGAGATCTCCTCGGGGTAGAATGCCTTGGTCTCCCCCTTGTAGCTCACCTGCACCTTGGGCTTGTCTCCGTCGTTGATCACCTGGAAAGGCCAGTGCTTCATGTCCGACTGCACCACCGGGTCGCCGAACTTGCGGCCAATCAGCCGCTTCGCGTCAAACACGGTGTTCTGCGGGTTCAGCGCCACCTGGTTCTTGGCCGCATCCCCGATGAGCCGCTCGGTGTCCGTGAAGGCCACGTAGCTGGGGGTGGTGCGGTTGCCCTGGTCGTTGGCGATGATCTCCACCTTGCCGTGTTGGAACACCCCCACGCAGGAGTAGGTGGTGCCCAGGTCGATGCCGATCGCCGCGGCTTTGGCCATGCCGGTTCCCTGCTCTCTGTCGGCTCCGCTCTGAGATTGGGGGCTGGAAACGGAACACTGGATCCGCGAGAAGAGCTCGGTCCTTCCGGACGCCGGAAACTCGACGCGCCGGTGCCTGCAGCCGCACAGGTTCGCTCTGGGAAGCCTTGGGACAACGGGAGTCACTCTCGAAAAAGGTAGTGGACTGTCGCAGCAGCTCCTCAGGCT