Transcript asmbl_141935

Sequence
Transcript Sequence for observation asmbl_141935 of TGE0058538:
ATCCAGCTCTTTTATTGAGATCAGTGGTGGCTCTGAAAAGAGCCTTTTGGGTTTTAGAAGTAGGCGTTCGCCTATTTCTTCTTGGGCGCCGCCTTCTTAGGCTTGACAACCTTGGGCTTAGCGGCCTTGGGCTTCACAGCCTTAGCAGCACTTTTGGCAGCTTTCTTGGGCTTCGCAACCTTGGCCTTCTTTGGGCTCTTAGCCACTTTCTTGGTTACAGTGGCCGCGGCCGGCTTCTTCGCTTTCTTCGGTGTTTTCTTAGCGCTCTTCTTCGGAGTTGCGCCGCCAGCCGCCTTCTTGGGCTTCTTGGCTGCCCCAACTGGCTTCTTAGGTTTGGTTCCGCCCGCCTTTTTAACCTTGGGCTTGGCTTCCCCGGAGGCTGCCTTCTTGTTGAGTTTAAAGGAGCCAGAAGCACCGGTGCCTTTCGTTTGCACCAGAGTGCCCTTGCTCACCAGGCTCTTGAGACCAAGTTTGATACGGCTGTTGTTTTTCTCCACATCATAGCCGGCGGCAGCCAACGCTTTTTTCAGAGCAGCCAGAGAAACTCCGCTACGCTCTTTAGAGGCGGCCACAGCCTTGGTGATGAGCTCTGACACCGGGGGACCAGACGCCTTACGAGGCGTACCCCCAGCCTTTTTGGCCGCCTTCTTCTTTACAGGGGCCTTCTCCGCAGGAGGCGCGGCAGCGGGAGCGGCAGGAGCAGTCTCGGACATGTTGAGAATCAAAAACTCGGGTACAAGTGGCAA