Transcript asmbl_140835

Sequence
Transcript Sequence for observation asmbl_140835 of TGE0058536:
TGCCCCGCGGCCGGGCCGGGGCAGCCGGGAAGCGGGTGGGGTGGTGTGTTACCCAGTAGCTCCTGGGACATCGCTCGGGTACGCTCCACGCCGTCGCAGCCACTGCTGTGGTCGCCGGTCGGCCGAGGGGCCGCGATACTGGTTGCCCGCGGTGTAAGCAGAATTCGACGTGTATCGCTGCCGTCAAGATGGAGGGGCCTTTGTCCGTGTTCGGTGACCGCAGCACTGGGGAAACGATCCGCTCCCAAAACGTTATGGCTGCAGCTTCGATTGCCAATATTGTAAAAAGTTCTCTTGGTCCAGTTGGCTTGGATAAAATGTTGGTGGATGATATTGGTGATGTAACCATTACTAACGATGGTGCAACCATCCTGAAGTTACTGGAGGTAGAACATCCTGCAGCTAAAGTTCTTTGTGAGCTGGCTGATCTGCAAGACAAAGAAGTTGGAGATGGAACTACTTCAGTGGTTATTATTGCAGCAGAACTCCTAAAAAATGCAGATGAATTAGTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGCTATCGACTTGCTTGCAAGGAAGCAGTGCGTTATATCAATGAAAACCTAATTGTTAACACAGATGAACTGGGAAGAGATTGCCTGATTAATGCTGCTAAGACATCCATGTCTTCCAAAATCATTGGAATAAATGGTGATTTCTTTGCTAACATGGTAGTAGATGCTGTACTTGCTATTAAATACACAGACATAAGAGGCCAGCCACGCTATCCAGTCAACTCTGTTAATATTTTGAAAGCCCATGGGAGAAGTCAAATGGAGAGTATGCTCATCAGTGGCTATGCACTCAACTGTGTGGTGGGATCCCAGGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCTTGCCTTGACTTCAGCCTGCAAAAAACAAAAATGAAGCTTGGTGTACAGGTGGTCATTACAGACCCTGAAAAACTGGACCAAATTAGACAGAGAGAATCAGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCAACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGATATGTGTCTGAAGTATTTTGTGGAGGCTGGTGCTATGGCAGTTAGAAGAGTTTTAAAAAGGGACCTTAAACGCATTGCCAAAGCTTCTGGAGCAACTATTCTGTCAACCCTGGCCAATTTGGAAGGTGAAGAAACTTTTGAAGCTGCAATGTTGGGACAGGCAGAAGAAGTGGTACAGGAGAGAATTTGTGATGATGAGCTGATCTTAATCAAAAATACTAAGGCTCGTACGTCTGCATCGATTATCTTACGTGGGGCAAATGATTTCATGTGTGATGAGATGGAGCGCTCTTTACATGATGCACTTTGTGTAGTGAAGAGAGTTTTGGAGTCAAAATCTGTGGTTCCCGGTGGGGGTGCTGTAGAAGCAGCCCTTTCCATATACCTTGAAAACTATGCAACCAGCATGGTAAGAACAGTCATTTCTTGTCTTAGAGGCCTGAGAGCAGTAGCTGTGGACTTCAATTTTTTTTTTCCCTTTTGTGAAG