Transcript asmbl_140832

Sequence
Transcript Sequence for observation asmbl_140832 of TGE0056696:
TGCCCCGCGGCCGGGCCGGGGCAGCCGGGAAGCGGGTGGGGTGGTGTGTTACCCAGTAGCTCCTGGGACATCGCTCGGGTACGCTCCACGCCGTCGCAGCCACTGCTGTGGTCGCCGGTCGGCCGAGGGGCCGCGATACTGGTTGCCCGCGGTGTAAGCAGAATTCGACGTGTATCGCTGCCGTCAAGATGGAGGGGCCTTTGTCCGTGTTCGGTGACCGCAGCACTGGGGAAACGATCCGCTCCCAAAACGTTATGGCTGCAGCTTCGATTGCCAATATTGTAAAAAGTTCTCTTGGTCCAGTTGGCTTGGATAAAATGTTGGTGGATGATATTGGTGATGTAACCATTACTAACGATGGTGCAACCATCCTGAAGTTACTGGAGGTAGAACATCCTGCAGCTAAAGTTCTTTGTGAGCTGGCTGATCTGCAAGACAAAGAAGTTGGAGATGGAACTACTTCAGTGGTTATTATTGCAGCAGAACTCCTAAAAAATGCAGATGAATTAGTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGCTATCGACTTGCTTGCAAGTAAGATTGTTTGCATTCAGAGAAATTTTTTTTGATGTAATAGTTGTAAACTGTGTTGTCTTAACGTTTTGATTAATAACTAAATTTTAATTTGAAAACCTTCAATTTAAATGTTTTAGCATTTAAGTAGTAATATTTGAAGTTAAAAACTTGGACCAGTATCTTTTTTCTCATTTGACTACCACATTTTCTCCTAATAATAGATTTTAGTGGCTATGCTTATGGGATAGATTAAACTTGCCATGATCTGAAGAGGGAGGGTTTTTTCATGTCCTCCTCCTATATGAAATGGCTGAACGGATATTATTACTTACGACATTTTGGCTCTGTGTTAAGCATGATGAATGCAAAGAGTTTGAGTAGTGACTTTATAAGCGTTTTTCTCCCCCACACTTTTAAACAGGGAAGCAGTGCGTTATATCAATGAAAACCTAATTGTTAACACAGATGAACTGGGAAGAGATTGCCTGATTAATGCTGCTAAGACATCCATGTCTTCCAAAATCATTGGAATAAATGGTGATTTCTTTGCTAACATGGTAGTAGATGCTGTACTTGCTATTAAATACACAGACATAAGAGGCCAGCCACGCTATCCAGTCAACTCTGTTAATATTTTGAAAGCCCATGGGAGAAGTCAAATGGAGAGTATGCTCATCAGTGGCTATGCACTCAACTGTGTGGTGGGATCCCAGGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCTTGCCTTGACTTCAGCCTGCAAAAAACAAAAATGAAGCTTGGTGTACAGGTGGTCATTACAGACCCTGAAAAACTGGACCAAATTAGACAGAGAGAATCAGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCAACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGATATGTGTCTGAAGTATTTTGTGGAGGCTGGTGCTATGGCAGTTAGAAGAGTTTTAAAAAGGGACCTTAAACGCATTGCCAAAGCTTCTGGAGCAACTATTCTGTCAACCCTGGCCAATTTGGAAGGTGAAGAAACTTTTGAAGCTGCAATGTTGGGACAGGCAGAAGAAGTGGTACAGGAGAGAATTTGTGATGATGAGCTGATCTTAATCAAAAATACTAAGGCTCGTACGTCTGCATCGATTATCTTACGTGGGGCAAATGATTTCATGTGTGATGAGATGGAGCGCTCTTTACATGATGCACTTTGTGTAGTGAAGAGAGTTTTGGAGTCAAAATCTGTGGTTCCCGGTGGGGGTGCTGTAGAAGCAGCCCTTTCCATATACCTTGAAAACTATGCAACCAGCATGGGGTCTCGGGAACAGCTTGCGATTGCAGAGTTTGCAAGATCACTTCTTGTTATTCCCAATACACTAGCAGTTAATGCTGCCCAGGACTCCACAGATCTGGTTGCAAAATTAAGAGCTTTTCATAATGAGGCCCAGGTTAACCCAGAACGTAAAAATCTAAAATGGATTGGTCTTGATTTGAGCAATGGTAAACCTCGAGACAACAAACAAGCAGGGGTGTTTGAACCAACCATAGTTAAAGTTAAGAGTTTGAAATTTGCAACAGAAGCTGCAATCACCATTCTTCGAATTGATGATCTTATTAAATTACATCCAGAAAGTAAAGATGATAAACATGGAAGTTATGAAGATGCTGTTCACTCTGGAGCCCTTAATGATTGATCTGATGTTCCTTTTATTTATAACAATGTTAAATGCAATTGTCTTGTACCTTGAGTTGAGTATTACACATTAAAGTAAAGTACAAGCTGTAAACTTGGGTTTTTGTGATGTAGGAAATGGTTTCCATCTGTACTTTGGTCCTCTGATTTCACATATTGCAACCTAGTACTTTATTAGTTTAAAAAGAAATTGAGGTTGTTCAAAGTTTAAGCAATTCATTCTCTCTGAACACACATTGCTATTCCCATCCCACCCCCAATGCACAGGGCTGCAACACCACGACTTCTGCCCATTCTCTCCAGTGTGTGTAACAGGGTCACAAGAATTCGACAGCCAGATGCTCCAAGAGGGTGGCCCAAGGCTATAGCCCCTCCTTCAATATTGACCTAACGGGGGAGAAAAGATTTAGATTGTTTATTCTTCTGTGGACACAGTTTAAAATCTTAAACTTGTCTTTTTCCTCTTAATGTATCAGCATGCTACCCTTTCAAACTCAAATTTTCATTTTAACTGCTTAGGAATAAATTTACACC