Transcript asmbl_140563

Sequence
Transcript Sequence for observation asmbl_140563 of TGE0056692:
TTCTTCTGGAGCCCTTGGAGGGGCTCCAAACTGAGAGGGGAGGGAAGACCGCAGGGAAAGGCGGACCTCAGTGTCTGAAAAGCCAGCTTAGAGTGGGAGGGCCTGGGAGTAGAAGGTAAAAAGGGAGTGGTGAGAATGAATGTGAGAAGGAAGCCAGGACAGCGCAGTCCCCAGTCCCGAACGGCCAGGGAGAGGAGGTGGCCTAGCGCTGGCGGGGCTCACCCCAATCCGTCTGCCTTTTGATGCCGTACTCTGCTGGTTGCGCAGCCACCTCGGGATACTGCACACGGAGAGGAGGGAAAATAAGCGAGGCACCGCCGCACCACGCGGGAGACCTACGGAGACCCACAGCGCCCGAGCCCTGGAAGAGCACTACTGGATGTCAGCGGAGAAATGGCTTTGAGCTCAGCCTGGCGCTCGGTTCTGCCTCTGTGGCTCCTCTGGAGCGCTGCCTGCTCCCGCGCCGCGTCCGGGGACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCAGCGGTTGGCAGGCAAGACCCGCCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTGCCGCCTGCGGCCGAGAAATGCAATGCTGGATTCTTTCACACCCTGTCGGGAGAATGTGTGCCCTGCGACTGTAATGGCAATTCCAACGAGTGTTTGGACGGCTCAGGATACTGTGTGCACTGCCAGCGGAACACAACAGGAGAGCACTGTGAAAAGTGTCTGGATGGTTATATCGGAGATTCCATCAGGGGAGCACCCCAATTCTGCCAGCCGTGCCCCTGTCCCCTGCCCCACTTGGCCAATTTTGCAGAATCCTGCTATAGGAAAAATGGAGCTGTTCGGTGCATTTGTAACGAAAATTATGCTGGACCTAACTGTGAAAGATGTGCTCCCGGTTACTATGGAAACCCCTTACTCATTGGAAGCACCTGTAAGAAATGTGACTGCAGTGGAAATTCAGATCCCAACCTGATCTTTGAAGATTGTGATGAAGTCACTGGCCAGTGTAGGAATTGCTTACGCAACACCACCGGATTCAAGTGTGAACGTTGCGCTCCTGGCTACTATGGGGACGCCAGGATAGCCAAGAACTGTGCAGTGTGCAACTGCGGGGGAGGCCCATGTGACAGTGTAACCGGAGAATGCTTGGAAGAAGGTTTTGAACCCCCTACAGGCTGTGATAAGTGCGTCTGGGACCTGACTGATGACCTGCGGTTAGCAGCGCTCTCCATCGAGGAAGGCAAATCCGGGGTGCTGAGCGTATCCTCTGGGGCCGCCGCTCATAGGCACGTGAATGAAATCAACGCCACCATCTACCTCCTCAAAACAAAATTGTCAGAAAGAGAAAACCAATACGCCCTAAGAAAGATACAAATCAACAATGCTGAGAACACGATGAAAAGCCTTCTGTCTGACGTAGAGGAATTAGTTGAAAAGGAAAATCAAGCCTCCAGAAAAGGACAACTTGTTCAGAAGGAAAGCATGGACACCATTAACCACGCAAGTCAGCTGGTAGAGCAAGCCCATGATATGAGGGATAAAATCCAAGAGATCAACAACAAGATGCTCTATTATGGGGAAGAGCATGAACTTAGCCCCAAGGAAATCTCTGAGAAGCTGGTGTTGGCCCAGAAGATGCTTGAAGAGATTAGAAGCCGTCAACCATTTTTCACCCAACGGGAGCTCGTGGATGAGGAGGCAGATGAGGCTTACGAACTACTGAGCCAGGCTGAGAGCTGGCAGCGGCTGCACAATGAGACCCGCACTCTGTTTCCTGTCGTCCTGGAGCAGCTGGATGACTACAATGCTAAGTTGTCAGATCTCCAGGAAGCACTTGACCAGGCCCTTAACTATGTCAGGGATGCCGAAGACATGAACAGGGCCACAGCAGCCAGGCAGCGGGACCATGAGGTACAGCGGACACTCACCATCAATGCATTTCAGCATCAGCAGTGTGATGGTACACCAAGAAGGGGCTGTTGATATAAATTTTTTTAAAATATTGGTATAGTTAAATACTTATATTTTAAAATATTGGTGTGTTTTTTGGTGCTATAAATTACTAACTTGTGTGTTCCTAAAATCAAGTTGAAACTAGGATAATTGTCTAGTTCTTGCTTTGATAAGAACGCAGTAGTTCTGATGCTTGTGTCCATGTGTATGGGTCTGTTATTCTTGCAAGTGGGTAAGCAATGCATAGCTTTTTTTATACTGAGAGCACTAGAAGGCCAAAGCATCTCAAAACCATGGGTTCTGGGTATGCATAATTTTTGGAAAGGCACGATAAGCAAATCTCACAGTCTGGCTGGTCAGCAGCTGCAGGGATAAGGAGACTAATTGCCAAGGCCATGCAAATGCAAAGAGGAAGGTGAGGAGGATTCCCAGATGTGATCATAGCTTGCAAAGATGGTCATCTCATGGGGCCAGAATTCGTGCATGCCCACACCTACAAAGCTGAGAACTGGTAGTGGTCATGTGTCCGCTTCAAGCAATGCATGTATTCACAGCCGCCAGCATCAAGAGGGGCCATCTTTTGATAGGATGACACATGCATGTTCAAACATATTTTAAAAGATTAGGGAGAAAAGAATACTGTGAACAAATAGAAACCAATTATGAGCAAATTCACGAATTCGGTTATGTACTATTGTGGCTGGCAAAAGCCACTTAAACTAGGCTCTCTAGCCTGATTTTCAGCCATCATTACCCCTCACTAAGAATCCTTGTAAAATTTCTTCCGTAAAAGTTAATTACACTCATCACCACTGTTTGCTAATGGGAGCAAACCCCTAGCCAATATT