Transcript asmbl_140335

Sequence
Transcript Sequence for observation asmbl_140335 of TGE0056946:
AATGCTCGAAGTATGCACACGTTCCCAAAAGTAGACCTCCTTCACCGCCGGAGGAGCATACATCACCCCGTGGCAGCCGTCCACCTTCTCAGGCGTTTCGTAACCGAGTAAACTGAGAGCTGGGAACAGCCCTCTATTAAGTAGCCCGCGGCGCGGAGTCTCTTTCCACTTGGCTAAGGCGAACCGCCCCAGACGCGTCCGCGCGCCGGCAGCTGCAGGCTCAGGCCATCTCCAGTCTTCCTGCCGCGCCCGCCTCTCCTCCTGGGATTCTCCTCCTCCTCCTGGACTTCCCCGCAGCTGCCCACGCCTCGGCGGCCGCCAGGTGCTCCTGGAGTGCAGCGCCTATCGCCGGGGCGTGTGGGGGCCACACCGAGCACCAGCTTCTCCGACGCCGGGAAGCCGCTGTCGCCGCCGCTACCTCTCCCTGTTGCCGCCGCCTCAGATCTCTTCATGCCGCTGTAAGCTCGGAGGCCAAGGATGCGGAGTAGGCTTCCCCCAGCGCTTGCCGCCCTGGGCGCGGCCCTGCTCCTGTCTTCCATTGAGGCAGAAGTTGACCCACCTTCAGACTTGAATTTTAAAATTATAGATGAAAATACTGTTCATATGTCATGGGCAAAACCAGTTGATCCAATTGTGGGTTACAGAATAACGGTGGACCCTACAACGGATGGGCCTACTAAAGAATTTACCCTTTCAGCTAGTACCACTGAAACTTTATTGTCAGAACTTGTACCTGAAACAGAGTATGTGGTGACAATAACTTCATATGATGAAGTAGAAGAAAGTGTACCAGTTATAGGACAACTAACAATTCAAACAGGTAGTTCGACAAAGCCAGTGGAGAAGAAACCTGGAAAAACCGAGATACAAAAATGCTCTGTCAGTGCCTGGACTGATTTGGTTTTCCTCGTGGATGGCTCTTGGAGTGTGGGAAGAAATAATTTCAAGTACATTTTAGACTTCATTGCTGCTCTTGTGTCTGCTTTTGACATTGGGGAAGAGAAGACAAGAGTTGGAGTTGTTCAATACAGCTCTGATACCAGGACTGAATTTAACTTAAATCAGTACTACCAAAGGGATGAACTTCTTGCTGCAATAAAAAAAATTCCATATAAAGGTGGCAACACAATGACAGGGGATGCCATTGATTATTTAGTTAAAAATACTTTCACGGAATCTGCTGGGGCAAGAGTTGGCTTTCCTAAAGTGGCAATTATTATTACGGATGGAAAATCCCAGGATGAAGTGGAAATTCCAGCAAGAGAGCTTCGTAATGTTGGAGTTGAAGTTTTCTCCTTGGGCATTAAAGCTGCAGATGCAAAAGAACTCAAACAAATTGCCTCCACACCTTCACTGAACCATGTTTTCAATGTGGCCAACTTTGATGCAATTGTGGATATTCAGAATGAGATCATCTCCCAGGTGTGCTCAGGTGTTGATGAACAACTTGGTGAATTGGTTAGTGGAGAAGAAGTTGTTGAGCCTCCTTCAAATTTGATTGCCATGGAAGTCTCTTCAAAATATGTTAAGCTAAATTGGAATCCATCTCCTAGTCCAGTGACTGGCTACAAAGTCATCCTCACACCAATGACTGCAGGAAGCCGACAGCACGCTCTGAGTGTGGGGCCTCAGACAACCACGCTCAGTGTTCGCGACCTCTCAGCAGACACAGAATACCAGATCAGTGTTTCCGCCATGAAGGGAATGACATCCAGTGAACCCATTTCAATAATGGAGAAGACTCAGCCAATGAAAGTTCAAGTGGAATGCTCACGTGGTGTGGATATAAAAGCCGATATTGTGTTTTTGGTTGATGGCTCCTATAGCATTGGGATTGCAAACTTTGTTAAAGTTAGAGCCTTTTTGGAAGTTCTTGTAAAAAGTTTTGAAATTTCACCAAATAGGGTCCAGATTAGTCTTGTGCAATACAGCCGGGATCCTCATACTGAGTTCACTTTGAAAAAATTCACCAAAGTTGAAGATATAATTGAAGCAATAAACACCTTCCCTTACAGAGGAGGATCTACAAATACTGGCAAAGCAATGACTTATGTCAGAGAGAAAATATTTGTGCCTAGCAAGGGATCAAGAAGCAATGTGCCAAAGGTCATGATTCTTATCACGGATGGGAAATCATCAGATGCTTTCAGAGATCCTGCGATAAAACTGAGGAATTCAGATGTTGAAATCTTTGCAGTTGGTGTGAAGGATGCCGTTCGCTCAGAATTGGAAGCTATTGCCTCTCCTCCTGCAGAGACCCATGTGTTCACAGTGGAAGATTTTGATGCTTTTCAGAGGATATCTTTTGAACTCACACAGTCTATCTGCCTTAGAATTGAGCAAGAATTGGCAGCTATAAAGAAGAAAGCTTACGTCCCTCCAAAGGATCTTAGTTTTTCAGAAGTGACTTCTTATGGTTTCAAAACCAACTGGTCTCCAGCTGGAGAAAATGTTTTTTCATATCACATCACCTACAAGGAAGCGGCTGGGGATGATGAGGTCACTGTGGTGGAGCCAGCATCGAGCACCAGTGTTGTTCTCAGCAGCCTGAAGCCAGAGACCTTGTATTTGGTCAATGTGACTGCGGAGTATGAGGATGGCTTCAGCATTCCCTTAGCTGGAGAGGAGACCACCGAAGAAGTAAAAGGAGCACCTCGAAACCTAAAGGTGACAGATGAGACTACAGATAGTTTCAAAATTACTTGGACTCAAGCTCCAGGGAGAGTTTTAAGATATCGAATTATATATAGACCAGTTGCTGGTGGAGAGAGCAGAGAAGTTACCACCCCACCCAATCAGAGGAGGAGAACACTGGAGAACTTGATTCCAGACACGAAATATGAAGTATCTGTAATTCCTGAATATTTCTCAGGACCTGGTACTCCATTAACTGGAAATGCAGCCACTGAAGAAGTTAGAGGGAATCCAAGAGACTTAAGAGTTTCTGACCCTACGACGTCTACTATGAAATTATCTTGGAGTGGGGCACCAGGAAAAGTGAAACAGTATCTCGTCACATATACCCCAGTGGCAGGGGGTGAAACTCAAGAGGTCACTGTGAGGGGAGATACAACCAATACGGTGCTGCAGGGATTGAAGGAAGGGACACAATACGCCTTATCTGTGACAGCCTTGTATGCGTCTGGGGCTGGAGACGCCCTCTTTGGTGAAGGAACAACACTTGAAGAACGTGGTTCTCCTCAAGATTTAGTTACTAAAGACATCACTGACACATCAATTGGGGCTTATTGGACATCTGCTCCAGGAATGGTTCGCGGTTACAGGGTCTCATGGAAATCACTTTATGATGATGTTGACACTGGAGAGAAAAATCTGCCTGAAGATGCAATTCATACGATGATAGAAAATCTGCAGCCAGAGACCAAATACAGAATTTCAGTATTTGCCACTTACAGCAGTGGAGAAGGAGAACCTTTGACTGGAGATGCCACAACTGAATTATCTCAAGATTCCAAAACCCTGAAAGTAGATGAAGAAACAGAAAACACAATGAGAGTTACATGGAAACCAGCACCAGGGAAAGTCGTCAACTACCGTGTTGTCTATCGCCCTCATGGGAGAGGGAAGCAAATGGTTGCTAAGGTGCCCCCCACAGTCACTTCGACAGTGTTAAAGCGACTTCAGCCACAGACCACATATGACATCACAGTTCTTCCTATTTACAAGATGGGAGAAGGAAAGCTTAGGCAAGGATCAGGAACAACAGCTTCTCGGTTTAAGTCTCCTAGAAACCTCAAAACATCTGACCCAACCATGTCAAGCTTCCGAGTGACTTGGGAGCCTGCCCCTGGGGAAGTGAAGGGTTATAAAGTCACATTCCACCCTACGGGGGATGACAGAAGACTGGGGGAGTTAGTGGTTGGACCCTATGACAACACAGTTGTTTTGGAGGAACTTAGGGCTGGTACCACCTATAAAGTAAATGTTTTTGGAATGTTTGATGGAGGAGAAAGCTCACCACTTGTTGGACAAGAAATGACAACCCTTTCCGACACAACTGTTATGCCAATTTTATCTTCTGGGATGGAGTGTCTCACCAGAGCTGAGGCAGACATTGTGTTGCTGGTGGATGGATCATGGAGCATCGGCCGGGCAAATTTTAGAACCGTGAGGAGTTTCATTTCTCGTATTGTGGAAGTCTTTGACATTGGCCCCAAAAGAGTACAAATTGCTCTTGCTCAGTATAGTGGGGATCCCAGAACAGAGTGGCAGTTAAATGCACACAGAGACAAGAAGAGCTTGTTGCAAGCTGTGGCAAACTTGCCGTACAAAGGAGGCAATACTCTCACAGGCATGGCTTTGAATTTCATTCGCCAACAGAACTTCAGGACCCAAGCTGGCATGAGACCTCGAGCTCGAAAAATTGGTGTGCTCATTACTGATGGAAAATCACAAGACGATGTTGAAGCACCTTCAAAGAAACTCAAGGATGAGGGAGTGGAGCTGTTTGCTATTGGTATTAAAAATGCTGATGAAGTCGAATTAAAGATGATTGCAACTGATCCTGATGATACCCATGCATACAATGTGGCAGATTTTGAGTCACTCTCCAGGATAGTGGATGATCTCACCATTAATTTGTGTAACAGTGTCAAAGGTCCAGGTGATTTGGAAGCACCTTCTAACTTAGTTATTTCTGAGCGAACCCATCGTTCTTTTAGAGTGAGCTGGACACCACCTTCTGACAGTGTGGATCGATATAAGGTGGAATACTATCCAGTTTCTGGAGGGAAACGTCAAGAATTTTATGTGAGTCGAATGGAAACTAGCACAGTGCTGAAAGATCTGAAACCTGAAACTGAATATGTTGTCAATGTGTATTCTGTGGTAGAAGATGAATATAGTGAGCCTCTGAAGGGGACAGAAAAAACCTTGCCAGTGCCTGTAGTCAGCCTGAATATTTATGATGTTGGCCCTACCACCATGCATGTGCAGTGGCAGCCTGTGGGAGGAGCTACTGGCTACATCTTGTCATACAAACCTGTTAAGGACACAGAGCCAACAAGACCCAAAGAGGTGCGTTTGGGGCCAACAGTGAATGACATGCAGCTGACTGACCTTGTTCCCAACACGGAGTATGCAGTCACAGTCCAGGCTGTCCTGCACGACCTCACTAGTGAACCTGTCACTGTTCGGGAAGTCACCTTGCCTTTACCCAGACCTCAGGATCTGAAACTCAGAGATGTGACTCACAGCACTATGAATGTCTTTTGGGAACCTGTGCCTGGAAAAGTGCGTAAATATATTGTTCGATACAAAACACCAGAAGAGGATGTCAAAGAGGTAGAGGTGGACAGATCAGAGACCAGCACTTCCCTCAAAGACCTCTTCTCACAGACCTTGTACACAGTCAGCGTTTCTGCAGTACATGACGAGGGGGAGTCTCCTCCAGTGACTGCTCAAGAAACTACCCGACCCGTGCCAGCCCCAACAAACTTAAAGATTACTGAAGTAACATCAGAGGGTTTCAGAGGGACTTGGGATCATGGAGCTTCAGATGTGTCTCTCTACAGAATAACTTGGGCACCTTTTGGAAGCTCAGATAAGATGGAGACCATCTTAAATGGAGATGAAAACACTTTGGTGTTCGAAAACCTGAACCCCAACACCATCTATGAAGTTTCCATTACTGCCATCTATCCTGATGAGTCAGAAAGTGATGACCTGATTGGCAGTGAGCGCACACTGCCTATCTTAACAACACAAGCTCCCAAAAGTGGCCCACGAAACCTTCAAGTGTACAATGCAACATCTAACAGCCTGACTGTTAAGTGGGATCCTGCTAGTGGTCGTGTGCAGAAATATAGGATCACTTATCAGCCTTCCACAGGGGAAGGCAATGAGCAAACGACCACAATAGGAGGACGGCAGAACAGTGTGGTCCTGCAGAAACTGAAGCCAGACACTCCTTACACTATCACCGTATCCTCTCTGTATCCTGATGGTGAAGGAGGTCGGATGACGGGAAGAGGCAAGACCAAACCTCTAAACACTGTAAGGAACCTGAGAGTGTATGACCCTTCTACCAGCACCTTGAATGTCCGCTGGGACCATGCAGAGGGAAATCCTCGTCAGTACAAGCTCTTCTATGCACCAGCAGCAGGTGGTCCAGAGGAACTGGTACCAATCCCCGGGAATACCAATTATGCCATTCTTAGGAATCTGCAGCCAGATACCTCATACACTGTGACTGTAGTTCCCGTTTATACTGAAGGTGATGGGGGACGCACATCAGATACTGGAAGGACATTGATGAGAGGACTGGCAAGAAATGTCCAAGTATACAATCCTACACCTAACAGCCTCGATGTTCGCTGGGACCCTGCTCCAGGACCTGTGCTGCAATATCGCGTTGTGTATTCTCCTGTGGATGGCACAAGACCCTCAGAATCTATAGTAGTGCCAGGAAACACGCGCATGGTGCATCTGGAGCGGCTGATTCCGGACACACTCTATTCCGTGAACCTTGTGGCTCTGTACTCGGATGGAGAGGGAAATCCCAGCCCTGCCCAGGGCCGAACGCTACCACGCAGTGGACCAAGGAACCTGAGAGTCTTTGGTGAAACAACCAATAGCCTCTCGGTAGCCTGGGATCATGCTGATGGGCCAGTTCAGCAGTACAGGATCATCTATTCTCCCACTGTTGGTGATCCAATTGATGAATATACCACAGTCCCAGGCAGAAGAAACAATGTAATACTGCAGCCCCTGCAACCTGACACTCCATATAAAATTACTGTTATTGCTGTTTATGAAGATGGAGATGGTGGCCATCTAACAGGAAATGGAAGAACTGTGGGACTCCTTCCTCCTCAGAACATACACATCTCTGACGAATGGTATACAAGATTCAGGGTGTCCTGGGATCCTTCACCTTCTCCAGTTCTTGGATATAAAATAGTATATAAGCCAGTGGGTTCCAATGAGCCCATGGAAGCCTTTGTTGGAGAAATGACATCATATACCTTACACAATCTCAATCCCAGCACCACCTACGATGTGAATGTTTATGCTCAATATGATTCTGGACTCAGTGTCCCCTTGACAGATCAAGGCACTACATTATATTTAAATGTAACAGATCTGAAAACTTACCAGATTGGGTGGGATACATTCTGTGTCAAATGGTCACCTCACCGGGCAGCCACCTCCTACAGGCTAAAACTAAGCCCTGCAGATGGAACAAGGGGACAAGAAATTACAGTGCGTGGATCAGAAACCAGTCACTGCTTCACTGGCCTTTCACCAGACACTGATTATGGTGTCACTGTTTTTGTGCAGACACCAAATCTCGAGGGACCAGGAGTCTCTGTTAAAGAACATACCACTGTGAAACCAACAGAAGCCCCTACAGAGCCACCCACACCTCCTCCCCCTCCCACCATTCCACCAGCCCGGGATGTATGCAAAGGGGCCAAGGCAGATATTGTGTTCTTGACTGATGCCTCCTGGAGCATTGGGGACGATAATTTTAACAAAGTTGTAAAATTCATCTTCAATACTGTGGGAGGCTTTGATGAAATCAGTCCTGCTGGGATTCAGGTTTCATTTGTGCAATACAGCGATGAGGTCAAGTCTGAGTTCAAGCTGAACACGTACAATGACAAGGCCCTAGCCCTTGGGGCCCTCCAGAATATTAGGTACAGAGGAGGAAACACAAGAACAGGCAAGGCCCTCACGTTTATCAAGGAGAAAGTCTTGACTTGGGAGAGCGGCATGAGGAAGAATGTCCCTAAGGTGTTGGTTGTGGTCACGGACGGTCGGTCCCAGGATGAGGTCAAGAAGGCGGCTTTGGTCATCCAGCAGTCAGGGTTCAGTGTCTTTGTAGTTGGTGTGGCTGATGTCGACTACAATGAGCTTGCCAACATTGCCAGCAAACCAAGTGAACGGCACGTGTTCATTGTGGACGACTTTGAATCTTTTGAGAAGATCGAAGACAATCTTATTACATTTGTTTGTGAAACTGCCACTTCAAGTTGTCCTCTCATTTATTTGGATGGCTACACCTCACCAGGTTTTAAAATGCTTGAAGCATACAACCTGACAGAAAAGAATTTTGCTTCTGTACAAGGAGTATCTTTGGAGTCAGGGTCTTTCCCCAGCTACTCAGCATACAGGATTCAGAAGAATGCGTTTGTGAATCAGCCTACAGCAGACCTACACCCAAATGGACTCCCTCCTTCATACACGATTATATTATTATTCAGACTTCTCCCAGAAACTCCCAGTGACCCTTTTGCAATTTGGCAAATCACAGACAGAGACTACAAACCACAAGTTGGAGTGATTGCAGATCCTTCTAGCAAGACGTTATCATTCTTTAACAAGGATACAAGAGGCGAGGTGCAAACTGTTACATTTGACACAGAAGAAGTAAAGACATTATTTTATGGAAGTTTTCACAAGGTTCATATTGTAGTGACCTCAAAAAGTGTTAAGATTTACATTGACTGCTATGAAATTATAGAAAAAGACATCAAGGAAGCTGGAAATATAACAACTGATGGTTATGAAATTCTTGGAAAACTCCTTAAAGGGGAAAGGAAATCAGCCGCATTCCAAATCCAGAGTTTTGACATTGTCTGCAGTCCAGTGTGGACCAGTAGAGACAGATGCTGTGATATTCCCTCTAGGAGAGATGAGGGAAAATGCCCTGCTTTTCCAAATTCTTGCACATGTACACAGGACAGCGTTGGACCTCCAGGACCTCCAGGCCCTGCAGGAGGACCTGGTGCTAAAGGTCCCAGAGGTGAAAGAGGTATCAGTGGGGCAATTGGGCCCCCTGGTCCTCGTGGAGACATAGGTCCTCCAGGCCCCCAGGGTCCTCCAGGCCCTCAGGGACCCAATGGACTCTCTATTCCGGGAGAGCAAGGTCGCCAAGGGATGAAAGGTGATGCTGGAGAGCCAGGACTTCCAGGCCGAACAGGAACCCCAGGATTACCTGGCCCACCAGGACCAATGGGACCTCCAGGAGACAGAGGCTTCACTGGAAAAGACGGTGCAATGGGACCCAGGGGCCCACCAGGGCCGCCGGGAAGCCCAGGCTCCCCAGGAGTCACAGGACCAAGTGGGAAGCCAGGAAAACCTGGAGATCATGGCAGACCAGGTCCATCTGGGTTGAAAGGAGAAAAAGGTGATAGGGGAGACATTGCTTCCCAGAACATGATGCGAGCAGTTGCAAGACAAGTCTGTGAACAATTGATAAGTGGTCAGATGAACAGATTCAATCAGATGCTGAATCAGATTCCAAATGATTACCAGTCCAGTCGCAACCAGCCAGGCCCGCCGGGTCCACCGGGACCTCCTGGTAGCGCAGGAGCCAGAGGAGAACCTGGGCCTGGGGGGCGGCCAGGCTTCCCGGGCACACCAGGGATGCAGGGACCCCCTGGGGAACGAGGTTTGCCAGGAGAGAAAGGTGAAAGGGGTACTGGATCTTCAGGACCTCGGGGGCTGCCTGGCCCCCCAGGTCCACAAGGAGAATCCAGAACAGGTCCACCAGGGTCCACAGGTTCAAGAGGTCCCCCTGGCCCCCCTGGCCGTCCTGGAAACTCAGGTATCCGAGGACCCCCAGGTCCTCCTGGATACTGTGATTCTTCTCAGTGTGCCAGCATCCCATACAACGGGCAAGGCTATCCAGAGCCTTACGTGCCCGAGGGCGGGGCCTACCTGCCTGAGCGCGAGCCCTTCATCGTGCCGGTGGAGCCCGAGCGGACAGCGGAATACGAGGACTACGGCGCAGACGAGCCTGCAGAGGAGCCTCCTGAGCCCCACCGGCGCTGGCGGCGCGCCCTGCCCCACGGACCCGGGCAGTGAACCAGAGATCACGCGCCGCGCCGCGAGGCTTGGGGGAGGTGTTGAAATTCTCATTTACAGGTCAGATAGAGCAGTGTACGTCTTTTCTGAGGTGTTTCTTCCAGCGTTGCTCATCCAGGAGTACCCTTTCTGATTGTAGAGAACCTTGTTTCTGCAGGAAGCCTAGCTCCAAGCACGCAGTCTGTAGACATTTTTGCCTTTGCCCTTGAAATGCTTGCAAAATACTTTGTTAACAAAAGCTGCAAAGAGAGAACATGCCGTGTGCCTTTAGTTAGCACAGCGGGCAGCCTCAGTGAAACTCTTAGGTTAAGCAGTTAAGTCCTGGAACCCAGAGCTGCTGTGTATTTCGAGCGGGCAGTTTATCTTTTGCTATACTTATTTTCAATTCAATTACACCACGATTCAAATAATTCCCCTCCTAAAACCAAAAAGGAGGGAAACGTCAACTCCATTGCAATTACTTATCTTCCTCTTCTATCTCTGTTATACGCCGGGGCATAGAATGCTCGTATACATCTCTTTAACAACCACAAACCTTAAGCCATGTAGATGAAGTTAGTGCATCAACGGGATACAGTTCCATATTGCCTTAAACCTCCTTGTTTTAGACACACTAACATTTATACCAAATTGCAGATTATTCTGCAGAGAGGGAATTGCATGTTTGTGTTGTATATTTAGTATGAACTTTTTTCAGAATATAATATTTCTTAGTTATCAAAAGTAGTTGGAAAACATTTGCAAGACTATGAACATAGAATTGCTGCTTTTATATTTTAACTGCAGATTGTGAATTTCACTGCCTTATATTATTTATTTCTGAAACAAAAGAGGCATTTTTCAATAAAACTACTGAAAATTTGA