Transcript asmbl_23604

Sequence
Transcript Sequence for observation asmbl_23604 of TGE0004288:
CGCACCGCGAATCACTTGTCAGCGCTCGTCTGAGGCGGAGGCAGCGCCGCGCCGGACCCGAGTTTCTTTCACTTTCTGGGATTGAATTTTGAGCCATCAAAACCATGAGCAACTACAGCGTGTCCTTGGTTGGTCCTGCTCCTTGGGGTTTCCGGCTGCAAGGTGGCAAAGATTTCAACATGCCTCTGACAATTTCTAGTTTAAAAGATGGCGGCAAAGCCTCCCAGGCGAATGTGAGAATAGGTGATGTGGTTCTCAGCATCGATGGAATAAGCGCCCATGGAATGACTCATCTTGAAGCCCAGAACAAGATTAAGGGTTGTACAGGCTCTTTGAATATGACTCTGCAAAGAGCATCTGCTACACCCAGGCCCGAGCCGGTTCCTGTTCAAAAGGGAGAACCTAAAGAAGTAGTTAAACCTGTACCCATTTCATCTCCTGCTGTGTCCAAAGTCACTTCCACAACCAACATGGCCTACAATAAGACACCACGGCCCTTTGGTTCTATGTCTTCACCAAAAGTCACATCCATCCCATCACCATCGTCCGCCTTCACCCCGGCCCACGCGACCACTTCATCACATGCTTCCCCTCCCGTGGCTGCTGTCACTCCTCCCCCATTCGCTGCATCTGGACTGCATGCTAATGCCAATCTTAGTGCTGACCAGCATTCACCTGCACTGAGCGCTGGTAAACCTGCAGTTAATGTCCCACGGCAGCCCACAGTCACCAGCGTGTGTTCCGAGACTGCTCAGGAGCTAGCAGAGGGACAGAGAAGAGGATCCCAGGGTGACAGTAAACAGCAAAATGGCCCACCGAGAAAACACATTGTGGACCGTAACACGGAGTTTTATCACATACCCACCCACAGCGATGCCAGCAAGAAGAGACTGATTGAGGATACAGAAGACTGGCGTCCGAGGACGGGCACAACGCAGTCTCGCTCTTTTCGAATCCTGGCCCAGATCACTGGGACTGAACATCTGAAAGAATCTGAAACTGATAATACAAAGAAGGCAAACAACACCCAGGAGCCTTCTCAGCATTTGGCTCCATCAGTAGCTTCAGCACGGAGCATGCCTGAGAGGCCAGGAAGCCCAGCCTCTGCCAGACCAGGGGTGGCTGGTCTCACAACTGCTGCTGCCTTCAAGCCTCTAGGATCCACCAGCACCATCAAGTCACCAAGCTGGCAACGGCCAAACCAAGCAGCACCTTACACTGGAAGAATCTCAAATAGTGCAGCTTCCTCAGGAGCAGTGGGACCAGCCGCCTCCTCTGTGGGGCAGCCCCAGCCAAGTGACCAGGACACTTTAGTGCAACGAGCTGAGCACATTCCAGCAGGAAAACGAACTCCAATGTGTGCCCACTGTAACCAGGTCATCAGGGGACCATTTCTAGTGGCACTGGGGAAATCTTGGCACCCAGAAGAATTCAACTGTGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTGGAGGAAAAGGGGGCCCTGTATTGTGAGCTCTGCTATGAGAAATTCTTTGCTCCTGAATGCGGTCGATGCCAAAGGAAGATCCTTGGAGAAGTCATCAATGCTTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTGGCCTGTGGAAAACCCATTCGTAATAATGTTTTTCACTTGGAGGATGGTGAACCCTATTGTGAGACGGATTATTATGCCCTCTTTGGTACTATATGCCGTGGATGTGAATTTCCCATAGAAGCTGGCGACATGTTTCTGGAGGCTCTGGGCTATACCTGGCATGACACTTGCTTCGTATGCTCAGTATGTTGTGAAAGTTTGGAAGGTCAGACCTTTTTCTCCAAGAAGGACAAGCCTCTTTGCAAGAAACATGCTCATGCTGTGAATTTTTGAAAGTCAACAGTTCAAGAGAAGAGAAGAAATTTGAAAAGAAAGAGGAGAATTAAAATTACCAATTAATTTTTAGATTTAATATTTATATGGAGTTTGAAAAATAATAGTGGCCCTGAAGGGATAAATTCCAGCTTTAAAAACCGAGTCTTTGAAGAAATATTTGGCTACATAACGTAAAGAGACAGTTTGGCATTTATTATTACTTTTTTCCCTGTATTTTCTGCCCATAAAATAACTTTCATAAAAATCAATTTCCTGGTTGACTATTAAATTCATCTTAGAATAAATTAGTAAAGAATTAAATTTTAGAAAATCTCAAACCTCTATGCTGAAATAATTATGGTTTCTTTCCTTGTTATGAGTAAATCTGTAAAAGGCAATGAAAGTGCCTTATACTTTTATCATTAAATGAAACATTGTATTTTTTTTAAGAATAATGTTTATCTTTAAAACAGTAAATAGGAGTTTAAACAGAGCATTTTATCAGTAGGTGTCAATTTTTACAAACTGTGTACATTTTTTTTGTCTTACAATCGATCATTCCAGTAGGAAAGATCAATGAGATTTTTCATCAAAATGCATCATGCCAATAAGAGATGCTATATTTTTCTTCATCCCTTTCAAAAGCTACCTACCATATGGCTTATAAATCTCAAATTTTTGCCTTTTATTAAAATATGGCCATTCCTATTCATTGTGTGTGTTTTATCGCCTATATTAGTCAAACTCTTTTTACCCCCGCTCCTTCATGCTGAGGTAAAGAGCTAATTGGATAACTTTGGACTGTAACAGTTTTCTCTCTATATAAAGAGAATAAGTAGGAAAGAATGTGGTTGTATCCAAAATATTCTCCTCCCCAATTCAGATCATGAATCGGTTTCAGAGTTGTACTACTGACAAGTGAAGGTTTGAGAACTCTCTTTGCAGAGTATTTTTTTCTTTAATTCTACATTAGAAAAATAAAAGATTGGCTTGGGGATGTGATAAAATCTTGATTGTTTTTTTCTTTTGATCATTCTCTTTCAGTAATAAATGAACCACTTCTAAAGGTGATCATGAAGTTTGGAAACTTTTATTCACAGAGGTTTGGTAGTATAGGAGGGCATATGATTAATTACTCAGACTAGCCCATTATTTGTTTTCTTCATTTGGGGAAAATTATGTGGATACCACATGAAGACAGAGAAACAATTGTGGTAAAATTGTAGATCCTATTGATATTTGCCCAGTGAGAAAAGCAATTATGGCATTTGATAGTTTTTCTCTTTGTTTTCAGATATGATGAAAGCCCATGATCCCACTAAGTTATAATTTAAATTCATTTGGAGCAAGATGCTTTTAAAGTTGAGGCTGAACCCGAAGTCTTTCCTGCCCCATCATCACTCACTAATTACTTCACTTCCATTGTGTACATGTTTGTTATAGAGGGAGGTTTTAAGCTACAATATTTGTTTAACCTCCCTAAGAACTTTTCAAGGCATCTGTCCTGAAAGTTGTTAATATATGGTCTAGCAGATTTAAATTATATACAGATAATAATTAACTGGGGATAAAAGAATGAGAAGGATGACACAAAGTGGCAAACTGAATACTTCACTTATAGTAACCCCAAACCACCTCCTCACCTTGCATCTTGCAGGGAGGCAGGAAGTTTTTTTGTTTTTTTTGTTTTTTAAGTGCTGTAACTGAATCATGCATTATTTTTCATTGCTGCTGAAACTACCTATAGAAGACATGCTGGCTAATGTGCCTTGTCACATATCTTGATGTCAGCCTTTTGCTTCACACAGCATAAAATAAGTTGGTGGTTTTGTTTTGATGTGGTAGAAGTTTTTTTTGTTATTTAGTTTTGCATTTATGGATTTTATATACAAAAATTGTATTTGGTAAGTCAGTGGTAGTTCCTTCAAAGAATTTTATTTGACCTGGGTTTCTTATAAAGTTATATTAACAATATCATTTTTATAGACTTTTCTTTCTACATATTATTCATGGAGCATAATGTTGCATTTCTCTAAATTTTATCTCGAAAAAGGTAACATTACATCCTAATTTATCATTTTGTCTTTGTGCTTTGTCCTTCTCTTCTGTGACAGAGCTTTATATCTATAACTAAAACAGTTAATCCTGTGAAATAAATATTGATCATAACCCAGAAGAATCTCTATTTTCCAGTGGGGAATGCCATATTTAACATACCAGCATTAATCTTTTAATAACTGGCAGAGCACTTTATTCTTCTGGCGAGCTCCCTGAATATTTATTTTTCTGATTATAAATATTCCGAGTCAGTAGCATTTTTTAAATTATTACGTCTTCACTGTAGAGCATTTACTTTTAGTCTCTTTAGATGTATATTTTGAAATGCTGTACTTAGTATAATATAGATTAAAATCATAGTACATAACTTTAAAACATCCCTTATTTGGATTTCTCTGTTTCAAAATGCTAGTGATAGGTTCAAATTTCTCTAGACTTACAAGGACAGAACGTTGCCCGCCATAGTAGCAGCCAAAAAATGGTCTTCTGTGCTTATGTTTATAGTAGCTTACACATTTCTATTGATTCAGGTTACATTAAGAATCTAAAACTAAAACTTAATTGTCTGGTCAGTATTAAGACAAACAAATAGTTTTAATCTTCAAATTATTAGTGCAGCATTATGTTTAAAAATTACCTACGACAAAATGTGTTAATGATACCATTTTCAAGGGGTACTATATTAGGACCACTTTTATAGAAAATAATTCCTCGGCCTCCGAATCTAGTAGTATGTTAACATTTTTGTGATGATTCAAAGGAGAGGCTTTTCAGACATAGGGAAGGGAAAACATACTGAATAATTTCACACAGATCTAACGTGGCTTCAGTTTGTCACTCTTCATCCCCTAATGTTTTAAGGTATTGGGTTTGAATTCTCAATGTATCATTTGCCTTATCTATTAATCTCTACTTTCTGTTTCTTTACGTTTTTAATTTTATATACGTCTATGCTGTTTTGCTTTTGCTTTTGGATGTATTTTCTAATTAAAAACCATGTGAGAAGTGTAATCAGTATAGTAATACCTTAATGAGCACATAATAAAT