Transcript asmbl_140008

Sequence
Transcript Sequence for observation asmbl_140008 of TGE0058535:
CAGGGGCAGCCCCAGGCAGTGCCTGTGAGCGGAGACCTCCGAGCGGTCGCCGTCTCGGGGCTGGACCCGGCCCGCAAGTACAAGTTCCTGCTCTTTGGACTCCAGAATGGGAAACGCCACGGCCCAGTCCCTGTGGAGGCCAGGACCGCCCCAGACACCAAACCGTCTCCCCGCCTGGGGGAGCTGACTGTGACAGATGCGACCCCTGACTCCGTGGGCCTCTCGTGGACGGTCCCTGAGGGCGAATTCGACTCCTTCGTGGTCCAGTACAAGGATAAGGATGGTCGGCTCCAGGTGGTGCCGGTGGCAGCCAACCAGCGGGAGGTCACAGTCCAGGGCCTGGAGCCCAGTAGGAAATACAGGTTCCTGCTCTATGGTCTGTCAGGCAGGAAACGACTGGGCCCCATCTCTGCTGACAGCACCACAGCTCCCCTGGAGAAGGAGCTACCTCCCCACCTGGGGGAACTGACCGTGGCTGAGGAGACCTCCAGCTCTCTGCGCCTGTCCTGGACGGTAGCCCAGGGCCCCTTTGACTCCTTCGTGGTCCAGTACAGGGACACGGACGGGCAGCCCAGGGCAGTGCCTGTGGCCGCAGACCAGCGCACAGTCACCGTAGAGGACCTGGAGCCTGGCAAGAAATACAAGTTTCTGCTCTACGGGCTCCTTGGGGGAAAGCGCCTGGGCCCGGTCTCTGCCCTGGGAATGACAGCCCCAGAAGAGGACACACCAGCCCCAGAGTTAGCCCCAGAGGCCCCTGAGCCTCCTGAAGAGCCCCGCCTAGGAGTGCTGACCGTGACCGACACAACCCCAGACTCCATGCGCCTCTCGTGGAGCGTGGCCCAGGGCCCCTTTGATTCCTTCGTGGTCCAGTATGAGGACACGAACGGGCAGCCCCAGGCCTTGCTCGTGGACGGCGACCAGAGCAAGATCCTCATCTCAGGCCTGGAGCCCAGCACCCCCTACAGGTTCCTCCTCTATGGCCTCCATGAAGGGAAGCGCCTGGGGCCCCTCTCAGCTGAGGGCACCACAGGGCTGGCTCCTGCTGGTCAGACCTCAGAGGAGTCAAGGCCCCGCCTGTCCCAGCTGTCTGTGACTGACGTGACCACCAGTTCACTGAGGCTCAACTGGGAGGCCCCACCGGGGGCCTTCGACTCCTTCCTGCTCCGCTTTGGGGTTCCATCACCAAGCACTCTGGAGCCGCATCCGCGTCCACTGCTGCAGCGCGAGCTGATGGTGCCGGGGACGCGGCACTCGGCCGTGCTCCGGGACCTGCGTTCCGGGACTCTGTACAGCCTGACACTGTATGGGCTGCGAGGACCCCACAAGGCCGACAGCATCCAGGGAACCGCCCGCACCCTCAGCCCAGTTCTGGAGAGCCCCCGTGACCTCCAATTCAGTGAAATCAGGGAGACCTCAGCCAAGGTCAACTGGATGCCCCCACCATCCCGGGCGGACAGCTTCAAAGTCTCCTACCAGCTGGCGGACGGAGGGGAGCCTCAGAGTGTGCAGGTGGATGGCCAGGCCCGGACCCAGAAACTCCAGGGGCTGATCCCAGGCGCTCGCTATGAGGTGACCGTGGTCTCGGTCCGAGGCTTTGAGGAGAGTGAGCCTCTCACAGGCTTCCTCACCACGGTTCCTGACGGTCCCACACAGTTGCGTGCACTGAACTTGACCGAGGGATTCGCCGTGCTGCACTGGAAGCCCCCCCAGAATCCTGTGGACACCTATGACGTCCAGGTCACAGCCCCTGGGGCCCCGCCTCTGCAGGCGGAGACCCCAGGCAGCGCGGTGGACTACCCCCTGCATGACCTTGTCCTCCACACCAACTACACCGCCACAGTGCGTGGCCTGCGGGGCCCCAACCTCACTTCCCCAGCCAGCATCACCTTCACCACAGGGCTAGAGGCCCCTCGGGACTTGGAGGCCAAGGAAGTGACCCCCCGCACCGCCCTGCTCACTTGGACTGAGCCCCCAGTCCGGCCCGCAGGCTACCTGCTCAGCTTCCACACCCCTGGTGGACAGAACCAGGAGATCCTGCTCCCAGGAGGGATCACATCTCACCAGCTCCTTGGCCTCTTTCCCTCCACCTCCTACAATGCACGGCTCCAGGCCATGTGGGGCCAGAGCCTCCTGCCGCCCGTGTCCACCTCTTTCACCACGGGTGGGCTGCGGATCCCCTTCCCCAGGGACTGCGGGGAGGAGATGCAGAACGGAGCCGGTGCCTCCAGGACCAGCACCATCTTCCTCAACGGCAACCGCGAGCGGCCCCTGAACGTGTTTTGCGACATGGAGACTGATGGGGGCGGCTGGCTGGTGTTCCAGCGCCGCATGGATGGACAGACAGACTTCTGGAGGGACTGGGAGGACTATGCCCATGGTTTTGGGAACATCTCTGGAGAGTTCTGGCTGGGCAATGAGGCCCTGCACAGCCTGACACAGGCAGGTGACTACTCCATGCGCGTGGACCTGCGGGCTGGGGACGAGGCTGTGTTCGCCCAGTACGACTCCTTCCACGTAGACTCGGCTGCGGAGTACTACCGCCTCCACTTGGAGGGCTACCACGGCACCGCAGGGGACTCCATGAGCTACCACAGCGGCAGTGTCTTCTCTGCCCGTGATCGGGACCCCAACAGCTTGCTCATCTCCTGCGCTGTCTCCTACCGAGGGGCCTGGTGGTACAGGAACTGCCACTACGCCAACCTCAACGGGCTCTACGGGAGCACAGTGGACCATCAGGGAGTGAGCTGGTACCACTGGAAGGGCTTCGAGTTCTCGGTGCCCTTCACGGAAATGAAGCTGAGACCAAGAAACTTTCGCTCCCCAGCGGGGGGAGGCTGAGCTGCTGCCCACCTCTCTCGCACCCCAGTATGACTGCCGAGCACTGAGGGGTCGCCCCGAGAGAAGAGCCAGGGTCCTTCACCACCCAGCCGCTGGAGGAAGCCTTCTCTGCCAGCGATCTCGCAGCACTGTGTTTACAGGGGGGAGGGGAGGGGTTCGTACGGGAGCAATAAAGGAGAAACTGAGGTACCCGG