Transcript asmbl_140007

Sequence
Transcript Sequence for observation asmbl_140007 of TGE0058534:
CAGGGGCAGCCCCAGGCAGTGCCTGTGAGCGGAGACCTCCGAGCGGTCGCCGTCTCGGGGCTGGACCCGGCCCGCAAGTACAAGTTCCTGCTCTTTGGACTCCAGAATGGGAAACGCCACGGCCCAGTCCCTGTGGAGGCCAGGACCGCCCCAGACACCAAACCGTCTCCCCGCCTGGGGGAGCTGACTGTGACAGATGCGACCCCTGACTCCGTGGGCCTCTCGTGGACGGTCCCTGAGGGCGAATTCGACTCCTTCGTGGTCCAGTACAAGGATAAGGATGGTCGGCTCCAGGTGGTGCCGGTGGCAGCCAACCAGCGGGAGGTCACAGTCCAGGGCCTGGAGCCCAGTAGGAAATACAGGTTCCTGCTCTATGGTCTGTCAGGCAGGAAACGACTGGGCCCCATCTCTGCTGACAGCACCACAGCTCCCCTGGAGAAGGAGCTACCTCCCCACCTGGGGGAACTGACCGTGGCTGAGGAGACCTCCAGCTCTCTGCGCCTGTCCTGGACGGTAGCCCAGGGCCCCTTTGACTCCTTCGTGGTCCAGTACAGGGACACGGACGGGCAGCCCAGGGCAGTGCCTGTGGCCGCAGACCAGCGCACAGTCACCGTAGAGGACCTGGAGCCTGGCAAGAAATACAAGTTTCTGCTCTACGGGCTCCTTGGGGGAAAGCGCCTGGGCCCGGTCTCTGCCCTGGGAATGACAGCCTTGGGCCAAGCCTGGAAGATAAAAATGGAGCACCCCATGGCGCCCCTCACTCAGATTCTCCCCTGGGCTTCTCCCACGCAGCCCCAGAAGAGGACACACCAGCCCCAGAGTTAGCCCCAGAGGCCCCTGAGCCTCCTGAAGAGCCCCGCCTAGGAGTGCTGACCGTGACCGACACAACCCCAGACTCCATGCGCCTCTCGTGGAGCGTGGCCCAGGGCCCCTTTGATTCCTTCGTGGTCCAGTATGAGGACACGAACGGGCAGCCCCAGGCCTTGCTCGTGGACGGCGACCAGAGCAAGATCCTCATCTCAGGCCTGGAGCCCAGCACCCCCTACAGGTTCCTCCTCTATGGCCTCCATGAAGGGAAGCGCCTGGGGCCCCTCTCAGCTGAGGGCACCACAGGGCTGGCTCCTGCTGGTCAGACCTCAGAGGAGTCAAGGCCCCGCCTGTCCCAGCTGTCTGTGACTGACGTGACCACCAGTTCACTGAGGCTCAACTGGGAGGCCCCACCGGGGGCCTTCGACTCCTTCCTGCTCCGCTTTGGGGTTCCATCACCAAGCACTCTGGAGCCGCATCCGCGTCCACTGCTGCAGCGCGAGCTGATGGTGCCGGGGACGCGGCACTCGGCCGTGCTCCGGGACCTGCGTTCCGGGACTCTGTACAGCCTGACACTGTATGGGCTGCGAGGACCCCACAAGGCCGACAGCATCCAGGGAACCGCCCGCACCCTCAGCCCAGTTCTGGAGAGCCCCCGTGACCTCCAATTCAGTGAAATCAGGGAGACCTCAGCCAAGGTCAACTGGATGCCCCCACCATCCCGGGCGGACAGCTTCAAAGTCTCCTACCAGCTGGCGGACGGAGGGGAGCCTCAGAGTGTGCAGGTGGATGGCCAGGCCCGGACCCAGAAACTCCAGGGGCTGATCCCAGGCGCTCGCTATGAGGTGACCGTGGTCTCGGTCCGAGGCTTTGAGGAGAGTGAGCCTCTCACAGGCTTCCTCACCACGGTTCCTGACGGTCCCACACAGTTGCGTGCACTGAACTTGACCGAGGGATTCGCCGTGCTGCACTGGAAGCCCCCCCAGAATCCTGTGGACACCTATGACGTCCAGGTCACAGCCCCTGGGGCCCCGCCTCTGCAGGCGGAGACCCCAGGCAGCGCGGTGGACTACCCCCTGCATGACCTTGTCCTCCACACCAACTACACCGCCACAGTGCGTGGCCTGCGGGGCCCCAACCTCACTTCCCCAGCCAGCATCACCTTCACCACAGGGCTAGAGGCCCCTCGGGACTTGGAGGCCAAGGAAGTGACCCCCCGCACCGCCCTGCTCACTTGGACTGAGCCCCCAGTCCGGCCCGCAGGCTACCTGCTCAGCTTCCACACCCCTGGTGGACAGAACCAGGAGATCCTGCTCCCAGGAGGGATCACATCTCACCAGCTCCTTGGCCTCTTTCCCTCCACCTCCTACAATGCACGGCTCCAGGCCATGTGGGGCCAGAGCCTCCTGCCGCCCGTGTCCACCTCTTTCACCACGGGTGGGCTGCGGATCCCCTTCCCCAGGGACTGCGGGGAGGAGATGCAGAACGGAGCCGGTGCCTCCAGGACCAGCACCATCTTCCTCAACGGCAACCGCGAGCGGCCCCTGAACGTGTTTTGCGACATGGAGACTGATGGGGGCGGCTGGCTGGTGTTCCAGCGCCGCATGGATGGACAGACAGACTTCTGGAGGGACTGGGAGGACTATGCCCATGGTTTTGGGAACATCTCTGGAGAGTTCTGGCTGGGCAATGAGGCCCTGCACAGCCTGACACAGGCAGGTGACTACTCCATGCGCGTGGACCTGCGGGCTGGGGACGAGGCTGTGTTCGCCCAGTACGACTCCTTCCACGTAGACTCGGCTGCGGAGTACTACCGCCTCCACTTGGAGGGCTACCACGGCACCGCAGGGGACTCCATGAGCTACCACAGCGGCAGTGTCTTCTCTGCCCGTGATCGGGACCCCAACAGCTTGCTCATCTCCTGCGCTGTCTCCTACCGAGGGGCCTGGTGGTACAGGAACTGCCACTACGCCAACCTCAACGGGCTCTACGGGAGCACAGTGGACCATCAGGGAGTGAGCTGGTACCACTGGAAGGGCTTCGAGTTCTCGGTGCCCTTCACGGAAATGAAGCTGAGACCAAGAAACTTTCGCTCCCCAGCGGGGGGAGGCTGAGCTGCTGCCCACCTCTCTCGCACCCCAGTATGACTGCCGAGCACTGAGGGGTCGCCCCGAGAGAAGAGCCAGGGTCCTTCACCACCCAGCCGCTGGAGGAAGCCTTCTCTGCCAGCGATCTCGCAGCACTGTGTTTACAGGGGGGAGGGGAGGGGTTCGTACGGGAGCAATAAAGGAGAAACTGAGGTACCCGG