Transcript asmbl_13998

Sequence
Transcript Sequence for observation asmbl_13998 of TGE0002126:
AGCGGGTTGAGGTGTAAGCCCTGAGGAGGCAGCGTTTTCTGGGCTTCTGTCTGGTTCTCTCTCTCCAGAAGGTTCTGCCGGTTCCCCCAGCTCTGGGTACCCGGCTCTGCATCGCGTCGCCATGATGGGCCATCGTCCAGTGCTCGTGCTCAGCCAGAACACAAAGCGTGAATCCGGAAGAAAAGTTCAATCTGGAAACATCAATGCTGCCAAGACTATTGCAGATATCATCCGAACATGTTTGGGACCCAAGTCCATGATGAAGATGCTTTTGGACCCAATGGGAGGCATTGTGATGACCAATGATGGCAATGCCATTCTTCGAGAGATTCAAGTCCAGCATCCAGCGGCCAAGTCCATGATCGAAATTAGCCGGACCCAGGATGAAGAGGTTGGAGATGGGACCACATCAGTAATTATTCTTGCAGGGGAAATGCTGTCTGTAGCTGAGCACTTCCTGGAGCAGCAGATGCACCCAACAGTGGTGATCAGTGCTTACCGCAAGGCATTGGATGATATGATCAGCACCCTAAAGAAAATAAGTATCCCAGTCGACATCAGTGACAGTGATATGATGCTGAACATCATCAACAGCTCTATTACTACCAAAGCCATCAGTCGGTGGTCATCTTTGGCTTGCAACATTGCCCTGGATGCTGTCAAGATGGTACAGTTTGAGGAGAATGGTCGGAAAGAGATTGACATAAAAAAATATGCAAGAGTGGAAAAGATACCTGGAGGCATCATTGAAGACTCCTGTGTCTTGCGTGGAGTCATGATTAACAAGGATGTGACCCATCCACGTATGCGGCGCTATATCAAGAACCCTCGCATTGTGCTGCTGGATTCTTCTCTGGAATACAAGAAAGGAGAAAGCCAGACTGACATTGAGATTACACGAGAGGAGGACTTCACCCGAATTCTCCAGATGGAGGAAGAGTACATCCAGCAGCTCTGTGAGGACATTATCCAACTGAAGCCCGATGTGGTCATCACTGAAAAGGGCATCTCAGATTTAGCTCAGCACTACCTTATGCGGGCCAATATCACAGCCATCCGCAGAGTCCGGAAGACAGACAATAATCGCATTGCTAGAGCCTGTGGGGCCCGGATAGTCAGCCGACCAGAGGAACTGAGAGAAGATGATGTTGGAACAGGAGCAGGCCTGTTGGAAATCAAGAAAATTGGAGATGAATACTTTACTTTCATCACTGACTGCAAAGACCCCAAGGCCTGCACCATTCTCCTCCGGGGGGCTAGCAAAGAGATTCTCTCGGAAGTAGAACGCAACCTCCAGGATGCCATGCAAGTGTGTCGCAATGTTCTCCTGGACCCTCAGCTGGTGCCAGGGGGTGGGGCCTCCGAGATGGCTGTGGCCCATGCCTTGACAGAAAAATCCAAGGCCATGACTGGTGTGGAACAATGGCCATACAGGGCTGTTGCCCAGGCCCTAGAGGTCATTCCTCGTACCCTGATCCAGAACTGTGGGGCCAGCACCATCCGTCTACTTACCTCCCTTCGGGCCAAGCACACCCAGGAGAACTGTGAGACCTGGGGTGTAAATGGTGAGACGGGTACTTTGGTGGACATGAAGGAACTGGGCATATGGGAGCCATTGGCTGTGAAGCTGCAGACTTATAAGACAGCAGTGGAGACGGCAGTTCTGCTACTGCGAATTGATGACATCGTTTCAGGCCACAAAAAGAAAGGCGATGACCAGAGCCGGCAAGGCGGGGCTCCTGATGCTGGCCAGGAGTGAGTGCTAGGCAAGGCTACTTCAATGCACAGAACCAGCAGAGTCTCCCCTTTTCCTGAGCCAGAGTGCCAGGAACACTGTGGACGTCTTTGTTCAGAAGGGATCAGGTTGGGGGGCAGCCCCCAGTCCCTTTCTGTCCCAGCTCAGTTTTCCAAAAGACACTGACATGTAATTCTTCTCTATTGTAAGGTTTCCATTTAGTTTGCTTCCGATGATTAAATCTAAGTCATTT