Transcript asmbl_139932

Sequence
Transcript Sequence for observation asmbl_139932 of TGE0002344:
GTTTTCTCGATCTGCTGCTCGTCTCAGGCTCGTAGTTCGCCTTCAACATGCCGGAACCAGCGAAGTCCGCTCCCGCGCCCAAGAAGGGCTCGAAGAAAGCCGTGACTAAGGCGCAGAAGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCCGTATACGTGTACAAGGTGCTGAAGCAGGTCCACCCCGACACCGGCATCTCCTCTAAGGCCATGGGAATCATGAACTCCTTCGTCAACGACATCTTCGAACGCATCGCGGGTGAGGCTTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACCTCCAGGGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAGTTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCCGTCACCAAGTACACCAGCGCTAAGTAAACTTGCCAAGGAGGGACTTTCTCTGGAATTTCCTGATATGACCAAGAAAGCTTCTTATCAAAAGAAGCACAATTGCCTTCGGTTACCTCATTATCTACTGCAGAAAAGAAGACGAGAATGCAACCATACCTAGATGGACTTTTCCACAAGCTAAAGCTGGCCTCTTGATCTCATTCAGATTCCAAAGAGAATCATTTACAAGTTAATTTCTGTCTCCTTGGTCCATTCCTTCTCTCTAATAATCATTTACTGTTCCTCAAAGAATTGTCTACATTACCCATCTCCTCTTTTGCCTCTGAGAAAGAGTATATAAGCTTCTGTACCCCACTGGGGGGTTGGGGTAATATTCTGTGGTCCTCAGCCCTGTACCTTAATAAATTTGTATGCCTTTTCTC