Transcript asmbl_139828

Sequence
Transcript Sequence for observation asmbl_139828 of TGE0056691:
CCCAGGGCTTGAGCTGCTTCTCCAGCAGCTCCTAGCCATGAAACCACAAACACTTTGCCTCCCCCTTCTGAGTCTTGGTGCCCTCATCCATAATACGGTTACAATATATACCTCACAGGCTTGTTGTTGTGAGGTTCAAACTAAATCCTTTATAAAATGTCCCTGAAACATTGTAGGTATGCAACAAATGTTGGCTATCTCCCCCTTAGTAGAAATCCGACTTCATGTGCACTCAGAACATTCTGTGAGAAAGTAAAATTGCTCTCTTTAACCTCAACTTTAAAACCTAGGGATATATCTTCAAGTTTCCCCATTACCTAATGATGACTATTATATTTTTACTCAATTTTGAAATTTACAAGTCATGTTCACATAGATCTTATCTCACTCTGGCCTAAAATGCTCCCATAAAATTGGCAGAACAAATTTAATCATTTTTATTTTATAGAATCAGGAACTGAAGTTCATAGAGATTAACATGCACTTTCTACAAGGACACACCCACTATCGGAACCCAGGTTTCTTGCAGCAAATCTAGTATTCCTCTCAAATGCCATCTAGGTTTCACCTTGGCTGTTACTTTCTAGCCAACCCTTGACTCCACTGCCCCATGTGCTCCCAAAGTATCTTGTACTTATTCTTTCATGGTACTTATCGCACTGTATTGCAGGGCTTCTCAAGCCTGACTATCTAACAGAATTATGTGAGACTTTTTGTAAAATATAATGGATTTAGGGCCTCACGTGATTTAGGTCCCACCTCCTTAATCAGGCGTCTATTTTTGTTTAAAGTTCTCCAGGTGACTCTGATGCACAGAATCATGCTTACTAAAGCATAAACTCTCTAATGGCAGCAACCAAATCTATTTTGTTCATCATTAGGATTCTGAATCCTTAAACAATATCTGGCAATACTATTCAATATTATTATCAATAACATTTACTGAGCATTTACTCTATGCCAGACACTATGATAAGTAATGTGTGTGCATTTGTTTCTGTTAATTCTGCCAATCGTCCTATGAAGAAGGAGTTATTATCACCCTATTTAAAGAGTGGGTAACTGAGGCTTGGAGAGGAGCTTGGGAAACATTTAGTAAATACATCAATGACTATTAGCAGTACAATTCATGCTTCCTACCTGCTTCCATGATAATAACTGGAACCTTCAAGAAAGTGATTATAAAATATGTAATAAAGGACTCTGGTACAGTCAGCTTTCAGGCACACATTAGTCATTGTCTCTAGAAAGTAGAATAGTAAAGCAGAGCCTTGGGAGAGCTTGGGGGCAGACAGCATGGCCCCAAGACACTATTTCTGAGTCCCACAAATAGCACATTTTAGTTGCTGAACCAATAGAAAATAGCCTGAATTCCTCCTAGATCATCTAATATTATTGTTCAATTTAAATACTTTTGGCTTCAAGTAGCAGAACTAATGTGGCTGAAACAGATGGGGACTGATTTTCTCATATAAGAAATCCTGAAATAGGTGGTCCTGATGCGGGCTTAGCCATTTAACAGCATCATTAAGGCCCCCAAATCCCCAAACGCCTCTCAGCTTTCTACTCTGCCACCTTCTCATTGTCAGCAGTGTTTCTGTTCACTGTCTCACGATGGCCACAGCAGCTTCAAGCATCCCTTCACCTGAAAACACCTGAAAACAGCTGAAAGCAGAAGGGGAAGGACAAACTCATCCATGTACCTCTCTCCTTTTTCAAAGGGGAAAAATGTTTCCCAGAAGCCACCTAGCAGACTTCCTCTTCCTCCTGGCAGTAGGTCACATAGCCACAGTTAGCCCAAAAGAAGTCCAGGGAAGCAAGCGATGGGCATGGTGGCATGGCATTGTCTTCTCTCCTGTGAGAGGTAGGACTTATCACAAGGACAGAGGAGGGAGAAAAATGGTTGCTTCTTAGACAGTTTATTATCTCAGCCTCAAATAATCTTTATTTAAAGTACTACTAAATCAACTAGATTCGCCTTTAGAATATTTTCAAAACCTGTTTGGCCCTATGATACGAATCCAATGTTGTTGAAGAAAGGGGCATGTCAGCTCCAGAGATCTCTAGACGACTGCTCTATGGACAGTTAAAGACTTTGGCAACAGCAGACATGTGATGATGGCTAATGCTCTCCTCTCCTGTTTCCAGGTCAACAGCGACCTCATTTACATTACAGCTAAGAAAGATGGCACTCATGTGGTGGAAAATGTGGATGCCACCCACATTGGGAAATTAATTGTGACCAAACAAATTGGAGGAGATGGCATGATGGATATTACTGATACTTACAAATTCCAAGAAGGTCAAGAAGAAGAGAGATTGGCCCTAGAAACTGCCCTGATGTACGGAGCTAAAAAGCCCCTCAACACAGAAGGTGTCATGAAATCAAGGTCCAACGTTGACATGGACTTTGAAGTGGAAAATGCTGTGCTGGGAAAAGACTTCAAGCTCTCCATCACCTTCCGGAACAACAGCCACAACCGTTACACCATCACAGCTTATCTCTCAGCCAACATCACCTTCTACACCGGGGTCCCGAAGGCAGAATTCAAGAAGGAGACGTTCGACGTGACGCTGGAGCCCTTGTCCTTCAAGAAAGAGGCGGTGCTGATCCAAGCCGGCGAGTACATGGGTCAGCTGCTGGAACAAGCGTCCCTGCACTTCTTTGTCACAGCTCGCATCAATGAGACCAGGGATGTTCTGGCCAAGCAAAAGTCCACCGTGCTAACCATCCCTGAGATCATCATCAAGGTCCGTGGCACTCAGGTAGTTGGTTCTGACATGACTGTGACAGTTGAGTTTACCAATCCTTTAAAAGAAACCCTGCGAAATGTCTGGGTACACCTGGATGGTCCTGGAGTAACAAGACCAATGAAGAAGATGTTCCGTGAAATCCGGCCCAACTCCACCGTGCAGTGGGAAGAAGTGTGCCGGCCCTGGGTCTCTGGGCATCGGAAGCTGATAGCCAGCATGAGCAGTGACTCCCTGAGACATGTGTATGGCGAGCTGGACGTGCAGATTCAAAGACGACCTTCCATGTGAATGCACAGGAAGCTGAGATGAACCCTGGCATTTGGCCTCTTGTAGTCTTGGCTAAGGAAATTCTAACGCAAAAATAGCTCTTGCTTTGACTTAGGTGTGAAGACCCAGACAGGACTGCAGAGGGCTCCAGAGTGGAGATCCCACATATTTCAAAAACATGCTTTTCCAAACCCAGGCTATTCGGCAAGGAAGTTAGTTTTTAATCTCTCCACCTTCCAAAGAGTGCTAAGCATTAGCTTTAATTAAGCTCTCATAGCTCATAAGAGTAACAGTCATCATTTATCATCACAAATGGCTACATCTCCAAATATCAGTGGGCTCTCTTACCAGGGAGATTTGCTCAATACCTGGCCTCATTTAAAACAAGACTTCAGATTCCCCACTCAGCCTTTTGGGAATAATAGCACATGATTTGGGCTCTAGAATTCCAGTCCCCTTTCTCGGGGTCAGGTTCTACCCTCCATGTGAGAATATTTTTCCCAGGACTAGAGCACAACATAATTTTTATTTTTGGCAAAGCCAGAAAAAGATCTTTCATTTTGCACCTGCAGCCAAGCAAATGCCTGCCAAATTTTAGATTTACCTTGTTAGAAGAGGTGGCCCCATATTAACAAATTGCATTTGTGGGAAACTTAACCACCTACAAGGAGATAAGAAAGCAGGTGCAACACTCAAGTCTATTGAATAATGTAGTTTTGTGATGCATTTTATAGAATGTGTCACACTGTGGCCTGATCAGCAGGAGCCAATATCCCTTACTTTAACCCTTTCTGGGATGCAATACTAGGAAGTAAAGTGAAGAATTTATCTCTTTAGTTAGTGATTATATTTCACCCATCTCTCAGGAATCATCTCCTTTGCAGAATGATGCAGGTTCAGGTCCCCTTTCAGAGATATAATAAGCCCAACAAGTTGAAGAAGCTGGCGGATCTAGTGACCAGATATATAGAAGGACTGCAGCCACTGATTCTCTCTTGTCCTTCACATCACCCATGTTGAGACCTCAGCTTGGCACTCAGGTGCTGAAGGGTAATATGGACTCAGCCTTGCAAATAGCCAGTGCTAGTTCTGACCCAACCACAGAGGATGCTGACATCATTTGTATTATGTTCCAAGGCTACTACAGAGAAGGCTGCCTGCTATGTATTTGCAAGGCTGATTTATGGTCAGAATTTCCCTCTGATATGTCTAGGGTGTGATTTAGGTCAGTAGACTGTGATTCTTAGCAAAAAATGAACAGTGATAAGTATACTGGGGGCAAAATCAGAATGGAATGCTCTGGTCTATATAACCACATTTCTAAGCCTTTGAGACTGTTCCTGAGCCTTCAGCACTAACCTATGAGGGTGAGCTGGTCCCCTCTATATATACATCATACTTAACTTTACTAAGTAATCTCACAGCATTTGCCAAGTCTCCCAATATCCAATTTTAAAATGAAATGCATTTTGCTAGACAGTTAAACTGGCTTAACTTAGTATATTATTATTAATTACAATGTAATAGAAGCTTAAAATAAAGTTAAACTGATTATATTTGCATCTGTGC