Transcript asmbl_139807

Sequence
Transcript Sequence for observation asmbl_139807 of TGE0058533:
GCCCAGCCCGCCGGTCCACGCCGCGCACCGCTCCGAGGGCCAGCGCCACCCGCTCCGCAGCCGGCACCATGCGCGAGATCGTGCACATCCAGGCGGGCCAGTGCGGCAACCAGATCGGCGCCAAGTTTTGGGAGGTCATCAGCGATGAGCATGGGATCGACCCCACAGGCAGTTACCATGGAGACAGTGACTTGCAGCTGGAGAGAATCAACGTGTACTACAATGAGGCTGCTGGTAACAAATATGTACCTCGGGCCATCCTGGTGGATCTGGAGCCTGGCACCATGGACTCTGTCAGGTCTGGACCCTTCGGCCAGATCTTCAGACCAGACAACTTCGTGTTCGGCCAGAGTGGAGCCGGGAATAACTGGGCCAAGGGCCACTACACAGAGGGAGCCGAGCTGGTCGACTCGGTCCTGGATGTGGTGAGGAAGGAGTCAGAGAGCTGTGACTGTCTCCAGGGCTTCCAGCTGACCCACTCTCTGGGGGGCGGCACGGGGTCCGGGATGGGCACCCTGCTCATCAGCAAGATCCGGGAAGAGTACCCAGACCGCATCATGAACACCTTCAGCGTCATGCCCTCACCCAAGGTGTCAGACACGGTGGTGGAGCCCTACAACGCCACCCTCTCTGTCCACCAGCTGGTGGAAAACACAGATGAAACCTACTCCATTGATAACGAGGCCCTGTATGACATCTGCTTCCGCACCCTGAAGCTGACCACCCCCACCTACGGGGACCTCAACCACCTGGTGTCGGCCACCATGAGCGGGGTCACCACCTGCCTGCGCTTCCCGGGCCAGCTGAACGCAGACCTGCGCAAGCTGGCGGTGAACATGGTGCCCTTCCCTCGCCTGCACTTCTTCATGCCCGGCTTCGCGCCCCTGACCAGCCGGGGCAGCCAGCAGTACCGGGCGCTCACGGTGCCCGAGCTCACCCAGCAGATGTTCGACTCCAAGAACATGATGGCCGCCTGCGACCCGCGCCACGGCCGCTACCTGACGGTGGCTGCCATCTTCCGGGGCCGCATGTCCATGAAGGAGGTGGACGAGCAGATGCTCAACGTGCAGAACAAGAACAGCAGCTACTTCGTGGAGTGGATCCCCAACAACGTGAAGACGGCCGTGTGCGACATCCCGCCCCGCGGCCTGAAGATGTCGGCCACCTTCATCGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCACGGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAACGACCTGGTGTCCGAGTACCAGCAGTACCAGGACGCCACGGCCGACGAACAAGGGGAGTTCGAGGAGGAGGAGGGCGAGGACGAGGCTTAAAAACTTCTCAGATCAATCGTGCATCCTTAGTGAACTTCTGTTGTCCTCAAGCATGGTCTTTCTACTTGTAAACTATGGTGCTCAGTTTTGCCTCTGTTAGAAATTCACACTGTTGATGTAATGATGTGGAACTCCTCTAAAAATTACAGTATTGTCTGTGAAGGTATCTATACTAATAAAAAAGCATGTGTAGAA