Transcript asmbl_138668

Sequence
Transcript Sequence for observation asmbl_138668 of TGE0058532:
ACACCCTCCCGAAGGTCCAGCCCTTACCCGCCTTCCTACCACCTTAGGGGATTTGGCCCGGAGAACGAGATCACCCTCTCAATGAAAGGCAGATGTCCCTTTAAGGTTTGCTTCTACAGCCCGTGGACTTTAGCCTAAACACGGACCCGCGAAGCTGGCTTTATTTGTCCATGTCTCGGACAGAGCCTGGGAAGCTGCCAGTGAGATTTCAGAGACCAAGAGCGCGAAGGGGCGGGCGATGTGGCAATCCGTCTGGGATGTGAAAAGCGTGGAGCGCATTTAGAGGAATTCGACGAAAACACAGGAAATCACTCCTCTCCCGCTCCTGGGCGCCGCTGCCACTGGGGCAGAGGACTGGGAACCGCGGCAGCGGGATAAGTGGCCCAGCCAGAGAGCGCAGCTCCCGCGCCCGGTCCTGCCCTGCGAACCAGCGCGGCCCCCTGGCGCTGAGGCTGCTCCGGCCATGGCCCCTCGGCCCCGCGCCCGCCCAGGGGTCGCTGTCGCCTGCTGCTGGCTCCTCACTGTTGTTCTACGCTGCTGCGTATCATTCAATGTTGATGTGAAAAATTCAATGACTTTCAGCGGCCCGGTGGAAGACATGTTTGGATATACTGTTCAACAATATGAAAATGAAGAAGGAAAATGGGTGCTTATTGGTTCTCCGTTAGTTGGCCAACCCAAAAACAGAACTGGAGATGTCTATAAGTGTCCAGTTGGGAGAGGTGAATCATTACCTTGTGTAAAGTTGGATCTACCAGTTAATACATCAATTCCCAATGTCACAGAAGTAAAGGAGAACATGACATTTGGATCAACTTTAGTCACCAACCCAAATGGAGGATTTCTGGCTTGTGGGCCCTTATATGCCTATAGATGTGGACATTTGCATTACACAACTGGAATCTGTTCTGACGTCAGCCCCACATTTCAAGTCGTGAATTCCATTGCCCCTGTACAAGAATGCAGCACTCAACTGGACATAGTCATAGTGCTGGATGGTTCCAACAGTATTTACCCATGGGACAGTGTTACAGCTTTTTTAAATGACCTTCTTGAAAGAATGGATATTGGTCCTAAACAGACACAGGTTGGAATTGTACAGTATGGAGAAAACGTGACCCATGAGTTCAACCTCAATAAGTATTCTTCCACCGAAGAGGTACTTGTTGCAGCAAAGAAAATAGTCCAGAGAGGTGGCCGCCAGACTATGACAGCTCTTGGAATAGACACAGCAAGAAAGGAGGCATTCACGGAAGCCCGGGGTGCCCGAAGAGGAGTTAAAAAAGTCATGGTTATTGTGACAGATGGAGAGTCTCATGACAATCATCGACTGAAGAAGGTCATCCAAGACTGTGAAGATGAAAACATTCAACGGTTTTCCATAGCTATTCTTGGCAGCTATAACCGAGGAAATTTAAGCACTGAAAAATTTGTGGAGGAAATAAAATCAATTGCAAGTGAACCCACTGAAAAGCATTTCTTCAATGTCTCTGATGAATTGGCTCTAGTCACCATTGTTAAAACTCTGGGAGAAAGAATATTTGCCCTGGAAGCCACAGCTGACCAGTCAGCAGCTTCATTTGAAATGGAAATGTCTCAGACTGGCTTCAGTGCTCATTATTCACAGGACTGGGTCATGCTTGGAGCAGTAGGAGCCTATGATTGGAATGGAACAGTTGTCATGCAGAAGGCTAGTCAAATCATAATCCCTCGAAACACAACCTTTAATGTTGAGTCTACCAAAAAGAATGAACCGCTTGCTTCTTATTTAGGTTACACTGTAAACTCTGCTACTGCTTCTTCTGGAGATGTGCTCTATATTGCTGGACAGCCTCGGTACAATCATACAGGCCAGGTCATTATCTACAGGATGGAAGATGGAAACATCAAAATTCTCCAGACGCTCAGTGGAGAACAGATTGGTTCCTACTTTGGCAGTATTTTAACAACAACTGACATTGACAAGGATTCTAATACTGACATTCTTCTAGTCGGAGCCCCTATGTACATGGGAACAGAGAAGGAGGAGCAAGGAAAAGTGTATGTGTATGCTCTCAATCAGACAAGGTTTGAATATCAAATGAGCCTGGAACCTATTAAGCAGACGTGCTGTTCATCTCGGCAGCACAATTCATGCACAACAGAAAACAAAAATGAGCCATGCGGGGCTCGTTTTGGAACTGCAATTGCTGCTGTAAAAGACCTCAATCTTGATGGATTTAATGACATCGTGATAGGAGCTCCGCTGGAAGATGATCACGGGGGAGCTGTGTACATTTATCATGGAAGTGGCAAGACTATAAGGAAAGAGTATGCACAACGTATTCCATCAGGTGGGGATGGTAAGACACTGAAATTTTTTGGCCAGTCTATCCACGGAGAAATGGATTTAAATGGTGACGGTCTGACAGATGTGACTATTGGGGGCCTTGGTGGTGCTGCCCTCTTCTGGTCCCGAGATGTGGCCGTAGTTAAAGTGACCATGAATTTTGAGCCAAATAAAGTGAATATTCAAAAGAAAAACTGCCATATGGAGGGAAAGGAAACAGTATGCATAAATGCTACAGTGTGTTTTGATGTGAAATTAAAGTCTAAAGAAGACACGATTTATGAAGCTGATTTGCAGTACCGTGTCACCCTAGATTCACTAAGACAAATATCACGAAGTTTTTTCTCTGGAACTCAAGAGAGAAAGGTTCAAAGGAACATCACAGTTCGAAAATCAGAATGCACTAAGCACTCCTTCTACATGTTGGACAAGCATGACTTTCAGGACTCTGTGAGAATAACGTTGGACTTTAATCTTACCGATCCAGAAAATGGGCCTGTTCTTGATGATTCTCTACCAAACTCAGTACATGAATATATTCCCTTTGCCAAAGATTGTGGAAATAAGGAAAAATGTATCTCAGACCTCAGCCTGCATGTCGCCACCACTGAAAAGGACCTGCTGATTGTCCGATCCCAGAATGATAAGTTCAACGTTAGCCTCACAGTCAAAAATACAAAGGACAGTGCCTATAACACCAGGACAATAGTGCATTATTCTCCAAATCTAGTTTTTTCAGGAATTGAGGCTATCCAAAAAGACAGTTGTGAATCTAATCATAATATCACATGTAAAGTTGGATATCCCTTCCTGAGAAGAGGAGAGATGGTAACTTTCAAAATATTGTTTCAGTTTAACACATCCTATCTCATGGAAAATGTGACCATTTATTTAAGTGCAACAAGTGACAGCGAAGAACCTCCTGAAACCCTTTCTGATAATGTAGTAAACATTTCTATCCCGGTAAAATATGAAGTTGGACTACAGTTTTACAGCTCTGCAAGTGAATACCACATTTCAATTGCTGCCAATGAGACAGTCCCTGAAGTTATTAATTCTACTGAGGACATTGGAAATGAAATTAATATCTTCTACTTGATTAGAAAAAGTGGATCTTTTCCAATGCCAGAGCTTAAGCTGTCAATTTCATTCCCCAATATGACATCAAATGGTTACCCTGTGCTGTACCCAACTGGATTGTCATCTTCTGAGAATGCAAACTGCAGACCCCATATCTTTGAGGATCCTTTCAGTATCAACTCTGGAAAGAAAATGACTACATCAACTGACCATCTCAAACGAGGCACAATTCTGGACTGCAATACATGTAAATTTGCTACCATCACATGTAATCTCACTTCTTCTGACATCAGCCAAGTCAATGTTTCGCTTATCTTGTGGAAACCAACTTTTATAAAATCATATTTTTCCAGCTTAAATCTTACTATAAGGGGAGAACTTCGGAGTGAAAATGCATCTCTGGTTTTAAGTAGCAGCAATCAAAAAAGAGAGCTTGCTATTCAAATATCCAAAGATGGGCTACCGGGCAGAGTGCCATTATGGGTCATCCTGCTGAGTGCTTTTGCCGGATTGTTGCTGTTAATGCTGCTCATTTTAGCACTGTGGAAGATTGGATTCTTCAAAAGACCACTGAAAAAGAAAATGGAGAAATGAAATATTTTATGAAAGAAAATAATAACAATTATTCAATAATCTATCCTCAGGTTTGCCTCAAATATGTGACAAGAAATGTATAATTCATGACATAGTCATGTAACTATGTAATCCATCAGGGATTCATTACTTGGAAAATGACAGGTCATGCATTATCCAAAAACAATACCAAAAAGACATATTTTATAAAATGACAAAAAATATTTTACATAATTACTCATTTTTGTTGAGTAAGCAAAATTACAAAGTGTTTTTAAAAAAACCTGTACAAATATGTTTATGTATTAAATCACCATCCAAAATATTTAAGGAATATATAAAAAGATTTTTATGATCATAGAAACATCTATTTTCAAAACAATATAAATTAAGCTTTTCCCCTTGATTCCTGTTGGATATCCATGTTCAGCATGACAGTCAGCACTCGTAAATGCCAAGAAAAGAATTACCTGAAAAAGATCATTTCTCCCTATTCAAATGAGAATATTTTCCCTTGGTAGAATCCATATACAATATGGATTGAAAATTAAGTCACCAAGAATACATTTAGCATCTTTGTGTTGGGTTCTATACCTAAAAATTTTCCCTCCCTGCCCAAGGTGATTGGAAAGTACTGCAATTGAGCTAAAATTTTATCTAGGATGGAAAATCAGGATAGACTCGTTTAAAAACAAGTATATTAAATGGGTTAAATTAAGCTTTTACAGAACATGCTTAATTTTGATATTGAGCTCTAAATGCAAAACTCTTTTATACTGAAAAAACACTTAAAGTAGTTTTGTGTGGCATCACAGTGATTTGTCATGAAAAGCCATATATGGGGGACATGCTAAAATGGCTTCTGAATGAAATACGACAGCAGAGAAAGATGCCACTGAAATGCTGAAATTATCTTTGCTGAGCAGCTTTTGAATGCTAAGGGTTCCAGTATGTGACCCAAAGAAAGAGTTGTCTCAACTCCTTGGTACAGGGTTCATTCAAACCCCCAAGCTGTGAGAGTGTGTTTATTTTTAATTTTTTAAAAGGTATTTAATTTCCAACCACACTTCTTATTTTTTTGAAAAGACAATTTTCCATTTCAGTATTACATTTTACCAAGAAGTCACTGCTTTTTAGGTGTGTTGCATCAATATTTAAATAAAATCCCAGAAATGTATTTTAAAGAATTTCAGGTTTGAAAACTCAAACCAACAGGAAGATATCACACCTTTGTATGTGCTTCTTTGTTCTTGAAGTAGTCATTATGGTTCATTGGAATCTACTGTAGCATAAGCTCCTAGGTTGCTCCATTTCTTAGGAAAATAGCAATGAATGAATGTATAGTAGCTGCATGTGTGAACTACTGCTGTAAAGTTTGCTGACATTTCTGCAACAACATTTCTCCATCTGATTTACCAGAACCTGTAACAAGACCAGAACATGTATTCATCCAGAAACTCCTGGGCTCTGCTTTGTTCAAAGAGGAGCAAATCCACATAGAAATTAAATGTTATAAATTTATTTTTTTAAACTAATTTCCAAAGAATTTAGCTGAAGACTCAGAGTCAGCCTACCTCTTGACTCTCCACATCCGCATCTAAGATCCTGAAGGCCAAAGGAATGCGCCTGTGGGATGCCAAAGCCATCAGTAGCTGGAAGAAAGAATACCTCTTTCTAGAGGTTTGGTGTCCTCTTGCTGGCCTGTCATTATTTGGAAATACGCGCTTTTGGAATTTCCTTCATTTTCGCTATTTCCAGGTTCAGAAATCATACCTACCACTTGTTCTTTCTTTGCCCAGTAAAACTCAGGGTTTCTCTTATTCAGAGTTACCATGTTGCACACCCCCAGTGCTCAGCCTGCCCAGAAGCCCTTCTCTGATCTCAGCAAGATCTTAGTAGTAAAGCTAACGGATCCATTGAAATTCATACTCAGCATCTGTGACTACTAGACAAAGCCCATTTACTGAACCATAAGTGTGCACTTTTAAACTAAATTGTTAACTGAAAGGGAAAAAATAGAAATGAGGGCATTTTGAAGTTTTTAGAAAAGAGAGGAAGAGCTGTTGGCCAGATCAAAGAGATACTTATAAGCCCGGCACAATTTTTAACATAAGTCATTCCTGGCTATTAAGTAAAATATTTCATGAACCAGAAGTCCTGTTTCTCTAATATTATAATTTGTTGAGGTTTGTGTGTGTGTGTGTGTGCATGTGCAGACACATGTACACATATAAATTGAATACAAAAATAGCTCTATAACACCAAAAAACAGAGTTTACAGAAAATAAACACAAAAGCTATATCTGCAAGACAAGTTTGATTCATCTAGTTTCATATAGTTTCATATAGTTTCATTTTTATTAATATTTAGGTTTAACTTATAGTTCTGCAATTATTTAAAAAACAAGTACAGAGCGTTTGATTAAAAAAAGTCAACAAATGTTTCAAAACAGCTTTGTACAAATGTTATAAAACATATTTAATGATTAAGAAATGTACTAGACTCTATCATTTACTTTTAAAACATTTAATTAGAAAAACAGGTGATATTTAAGACTATTTATAAACTTATTGGCCAAATTGCCAAAAAGTTTCTTTTTCTCTAACTTTGGTATTCTAAATAATTGATTATTGCTCCCATTGTAAACTGAACCATGTATGCACTCTCTTTTCTGACCAAACTACAATGGTATATTGGTAAATTATTTAACAACACACTGTCCAGGAGGGAAAAAAAAAACAGTCTCTGATTTGTATCATTTGCCAATTTCCATGGTCCAAATATTCTCTCTCCATTTTCAAACTACCAAAGTGACCCTAATCAGCTTACAAAATTCCTGGAAATGTATCTGCCACCTCTTACCAACCAGTGTGAGCTGACTTCAGCACACCACTGAGACAGATTACACGATAGACAGATAGATAGATAGA