Transcript asmbl_131162

Sequence
Transcript Sequence for observation asmbl_131162 of TGE0058253:
GCCCCGCCCTTGGCCCAGCCGCTCGCTCGGCTCCGCTCCCTGGCTCGGCTCCCTGCCTCCGCGTCGCAGCCCCCGCCGTAGCCGCCTCCGAGCCCGCCGCCACATCCTCTGAGCAGAAGATGGCTGTGCCACCCACGTATGCCGATCTTGGCAAATCTGCCAGGGATGTCTTCACCAAGGGCTATGGATTTGGCTTAATAAAGCTTGATTTGAAAACAAAATCTGAGAATGGATTGGAATTTACAAGCTCAGGCTCAGCCAACACTGAGACCACCAAAGTGACGGGCAGTCTGGAAACCAAGTACAGATGGACTGAGTACGGCCTGACGTTTACAGAGAAATGGAATACCGACAATACACTAGGCACCGAGATTACTGTGGAAGATCAGCTTGCACGTGGACTGAAGCTGACCTTCGATTCATCCTTCTCACCTAACACTGGGAAAAAAAATGCTAAAATCAAGACAGGGTACAAGCGGGAGCACATTAACCTGGGCTGCGACATGGATTTCGACATTGCTGGGCCTTCCATCCGGGGTGCTCTGGTGCTAGGTTACGAGGGCTGGCTGGCCGGCTACCAGATGAATTTTGAGACTGCAAAATCCCGAGTGACCCAGAGCAACTTTGCAGTTGGCTACAAGACTGATGAATTCCAGCTTCACACTAATGTGAATGACGGGACAGAGTTTGGCGGCTCCATTTACCAGAAAGTGAACAAGAAGTTGGAGACCGCTGTCAATCTTGCCTGGACAGCAGGAAACAGTAACACGCGCTTCGGAATAGCAGCCAAGTATCAGATTGACCCTGACGCCTGCTTCTCGGCTAAAGTGAACAACTCCAGCCTGATAGGTTTAGGATACACTCAGACTCTAAAGCCAGGTATTAAACTGACACTGTCAGCTCTTCTGGATGGCAAGAACGTCAATGCTGGTGGCCACAAGCTTGGTCTAGGACTGGAATTTCAAGCATAAATGAATACTGTACAATTGTTTAATTTTAAACTATTTTGCAGCATAGCTACCTTCAGAATTTAGTGTATCTTTTAATGTTGTATGTCTGGGATGCAAGTATTGCTAAATATGTTAGCCCTCCAGGTTAAAGTTGATTCAGCTTTAAGATGTTACCCTTCCAGAGGTACAGAAGAAACCTATTTCCAAAAAAGGTCCTTTCAGTGGTAGACTCGGGGAGAACTTGGTGGCCCCTTTGAGATGCCAGGTTTCTTTTTTATCTAGAAATGGCTGCAAGTGGAAGCGGATAATATGTAGGCACTTTGTAAATTCATATTGAGTAAATGAATGAAATTGTGATTTCCTGAGAATCGAACCTTGGTTCCCTAACCCTAATTGATGAGAGGCTCGCTGCTTGATGGTGTGTACAAACTCACCTGAATGGGACTTTTTTAGACAGATCTTCATGACCTGTTCCCACCCCAGTTCATCATCATCTCTTTTACACCAAAAGGTCTGCAGGGTGTGGTAACTGTTTCTTTTGTGCCATTTTGGGGTGGAGAAGGTGGATGTGATGAAGCCAATAATTCAGGACTTATTCCTTCTTGTGTTGTGTTTTTTTTTGGCCCTTGCACCAGAGTATGAAATAGCTTCCAGGAGCTCCAGCTATAAGCTTGGAAGTGTCTGTGTGATTGTAATCACATGGTGACAACACTCAGAATCTAAATTGGACTTCTGTTGTATTCTCACCACTCAATTTGTTTTTTAGCAGTTTAATGGGTACATTTTAGAGTCTTCCATTTTGTTGGAATTAGATCCTCCCCTTCAAATGCTGTAATTAACAACACTTAAAAAACTTGAATAAAATATTGAAACCTC