Transcript asmbl_130204

Sequence
Transcript Sequence for observation asmbl_130204 of TGE0058530:
GGCAAAACTCAGTCTTAGCAGATTCAGTGTGGAAGCAGCTATCAAAAAGGCCATAAGGATTTTGTCCCCAAATTTCACATGAGCTACCTTGCTTCAAACTACTGAGATGAAGGGGGCAAGATTATTTGTCCTTCTTTCTAGTTTATGGAGTGGGGGCATTGGGCTTAACAACAGTAAGCATTCTTGGACTATACCTGAGGATGGGAACTCTCAGAAGACTATGCCTTCTGCTTCAGTTCCTCCAAATAAAATACAAAGTTTGCAAATACTGCCAACCACTCGGGTCATGTCGGCGGAGATAGCTACAACTCCAGAGGCAAGAACTTCTGAAGACAGTCTTCTTAAATCAACACTGCCTCCCTCAGAAACAAGTGCACCTGCTGAGGGTGTGAGAAATCAAACTCTCACATCCACAGAGAAAGCAGAAGGAGTGGTCAAGTTACAGAATCTTACCCTCCCAACCAACGCTAGCATCAAGTTCAATCCTGGAGCAGAATCAGTGGTCCTTTCCAATTCTACACTGAAATTTCTTCAGAGCTTTGCCAGAAAGTCAAATGAACAAGCAACTTCTCTAAACACAGTTGGAGGCACTGGAGGCATTGGAGGCGTTGGAGGCACTGGAGGCGTGGGAAATCGAGCCCCACGGGAAACATACCTCAGCCGGGGTGACAGCAGTTCCAGCCAAAGAACTGACTACCAAAAATCAAATTTCGAAACAACTAGAGGAAAGAATTGGTGTGCTTATGTACATACCAGGTTATCTCCCACAGTGATATTGGACAACCAGGTCACTTATGTCCCAGGTGGGAAAGGACCTTGTGGCTGGACCGGTGGATCCTGTCCTCAGAGATCTCAGAAGATATCCAATCCTGTCTATAGGATGCAACATAAAATTGTCACCTCATTGGATTGGAGGTGCTGTCCTGGATACAGTGGGCCGAAATGTCAACTAAGAGCCCAGGAACAGCAAAGTTTGATACACACCAACCAGGCTGAAAGTCATACAGCTGTTGGCAGAGGAGTAGCTGAGCAGCAGCAGCAGCAAGGCTGTGGTGACCCAGAAGTGATGCAAAAAATGACTGATCAGGTGAACTACCAGGCAATGAAACTGACTCTTCTGCAGAAGAAGATTGACAATATTTCTTTGACTGTGAATGATGTAAGGAACACTTACTCCTCCCTAGAAGGAAAAGTCAGCGAAGATAAAAGCAGAGAATTTCAATCTCTTCTAAAAGGTCTAAAATCCAAAAGCATTAATGTACTGATAAGAGACATAGTAAGAGAACAATTTAAAATTTTTCAAAATGACATGCAAGAGACTGTAGCACAGCTCTTCAAGACTGTATCAAGTCTATCAGAGGACCTCGAAAGCACCAGGCAAATAATTCAAAAAGTTAATGAATCTGTGGTTTCAATAGCAGCCCAGCAAAAGTTTGTTTTGGTGCAAGAGAATCGGCCCACTTTGACTGATATAGTGGAACTAAGGAATCACATTGTGAATGTAAGGCAAGAAATGACTCTTACATGTGAGAAGCCTATTAAAGAACTAGAAGTAAAGCAGACTCATTTAGAAGGTGCTCTAGAACAGGAACACTCAAGAAGCATTCTGTATTATGAATCCCTCAATAAAACTCTTTCTAAATTGAAGGAAGTACATGAGCAGCTTTTATCAACTGAACAGGTATCAGACCAGAAGAATGCTCCAGCTGCTGAGTCAGTTAGCAATAATGTCACTGAGTACATGTCTACTTTACATGAAAATATAAAGAAGCAGAGTTTGATGATGCTGCAAATGTTTGAAGATTTGCACATTCAAGAAAGCAAGATTAACAATCTCACCGTCTCTTTGGAGATGGAGAAAGAGTCTCTCAGAGGTGAATGTGAAGACATGTTATCCAAATGCAGAAATGATTTTAAATTTCAACTTAAGGACACAGAAGAGAATTTACATGTGTTAAATCAAACATTGGCTGAAGTTCTCTTTCCAATGGACAATAAGATGGACAAAATGAGTGAGCAACTAAATGATTTGACTTATGATATGGAGATCCTTCAACCCTTGCTTGAGCAGGGAGCATCACTCAGACAGACAATGACATATGAACAACCAAAGGAAGCAATAGTGATAAGGAAAAAGATAGAAAATCTGACTAGTGCTGTCAATAGTCTAAATTTTATTATCAAAGAACTTACAAAAAGACACAACTTACTTAGAAATGAAGTACAGGGTCGTGATGATGCCTTAGAAAGACGTATCAATGAATATGCCTTAGAAATGGAAGATGGCCTCAATAAGACAATGACTATTATAAATAATGCTATTGATTTCATTCAAGATAACTATGCCCTAAAAGAGACTTTAAGTACTATTAAGGATAATAGTGAGATCCATCATAAATGTACCTCCGATATGGAAACTATTTTGACATTTATTCCTCAGTTCCACCGTCTGAATGATTCTATTCAGACTTTGGTCAATGACAATCAGAGATATAACTTTGTTTTGCAAGTCGCCAAGACCCTTGCAGGTATTCCCAGAGATGAGAAACTAAATCAGTCCAACTTCCAAAAGATGTATCAAATGTTCAATGAAACCACTTCCCAAGTGAGAAAATACCAGCAAAATATGAGTCATTTGGAAGAAAAACTACTCTTAACTACCAAGATTTCCAAAAATTTTGAGACTCGGTTGCAAGACATTGAGTCTAAAGTTACCCAGACGCTCATACCTTATTATATTTCAGTTAAAAAAGGCAGTGTAGTTACAAATGAGAGAGATCAGGCTCTTCAACTGCAAGTATTAAATTCCAGATTTAAGGCGTTGGAAGCAAAATCTATCCATCTTTCAATTAACTTCTTTTCGCTTAACAAAACTCTCCACGAAGTTTTAACAATGTGTCACAATGCTTCTACAAGTGTGTCAGAACTGAATGCTACCATCCCTAAGTGGATAAAACATTCCCTGCCAGATATTCAACTTCTTCAGAAAGGTCTAACAGAATTTGTGGAACCAATAATTCAAATAAAAACTCAAGCTGCCCTATCTAATTTAACTTGTTGTATAGATCGATCGTTGCCTGGTAGTCTGGCAAATGTTGTCAAGTCTCAGAAGCAAGTAAAATCATTGCCAAAGAAAATTAACGCACTTAAGAAACCAACGGTAAATCTTACCACAGTCCTGATAGGCCGGACTCAAAGAAACACGGACAACATAATATATCCTGAGGAGTATTCAAGCTGTAGTCGGCATCCGTGCCAAAATGGGGGCACGTGCATAAATGGAAGAACTAGCTTTACCTGTGCCTGCAGACATCCTTTTACTGGTGACAACTGCACTATCAAGCTTGTGGAAGAAAATGCTTTAGCTCCAGATTTTTCCAAAGGATCTTACAGATATGCACCCATGGTGGCATTTTTTGCATCTCATACGTATGGAATGACTATACCTGGTCCTATCCTGTTTAATAACTTGGATGTCAATTATGGAGCTTCATATACCCCAAGAACTGGAAAATTTAGAATTCCGTATCTTGGAGTATATGTTTTCAAGTACACCATCGAGTCATTTAGTGCTCATATTTCTGGATTTTTAGTGGTTGATGGAATAGACAAGCTTGCATTTGAGTCTGAAAATATTAACAGTGAAATACACTGTGATAGGGTTTTAACTGGGGATGCCTTATTAGAATTAAATTATGGGCAGGAAGTCTGGTTACGACTTGCAAAAGGAACAATTCCAGCCAAGTTTCCCCCTGTTACTACATTTAGTGGCTATTTATTATATCGTACATAAGTTAGTATGAAAAACAGACTATCACCTTTATTGAGAAACAGCCAGTGTTTTCATTTATCTTTGCTTGCACATCTGCTCTGTTTTGGTTTTTCTACAGGAAATGAAAATCAACTTGTTTTTTTAATATGAGTAAACTTGTATGTCTATTTTATAAAATTATTTGAATATTGTTTAATGTCTGAATATGAAAGAGTTCTTGATCCTAAAGAAATTTAGTGGCACAGAAAACAAAGTGAATTTGTTAGCATAATTATTCCTATTCTTATTTCTTCATTTTAAGTCATTGCAATGGAAAGTAATATTATAAAATGGTAATTACAACATATTATCAGTCACAGTTTTCTTTCCAATTAAACACTTAACTTTTGTTATTCCCTGTATATAAATATATAACACACATTTTCTAGATTCACAAATTTAAATAAATTACTCAAAAAATGAAAATTGATTTTGTAAACTTTTATTTTTACTCTTTACGTTGAGTTGATCAATTTTCCATACTAAGATTTTCATTCAGAATCAAAATTAAGAAAGTTGGACTGAAAATATGAAAAATGCTTAACTATTGTTCTCTTCCTATAATTCTCTAATTATAACATAGTAATTTACATGTAGTTGGACATGTACACTCAAGTCTAAGAATATATGAGTGGATCATTTACCGCCCCCCGCCCCACAACATCTATAAGGGGCAAAAAGTCTTTTTCTAATAAGTATTCTTCTATGGTAGTACCTACAGATCTGCCCTTCTTCTTCTAAAGGGTAAGTCATAATCTGTGTAATACTACAATTTATGGGATGCTCACTATGCCCTGTTTCTCTTCTAAACAATTTACATGTAATGTCTCATTCCTCACAATAACCCTTGTAAAGTGGGCATGATTACCATGATTTTTATAGTTGAAGAACCTAAGACACAGAGACCAAGGCCCATGAGCTCATAGGGCTGAGGCAGGATTTGGAATCAGGCCATGTCTTCTCCAGAGCCCACATCCATCCTTTCTCTATATTGCCTCCCACAGATGTGCTAAAATTTATTTAACTAATCCTTTATCCTCTATTTGTGTTGTCTCCCATTTTTTATTATTACAATATTACTGTGGTGAACATGCTTAAAAATACATTCCTTGGATATCTGACAACGTGTTTCTGAAAAACAGATTTTCATAAGTAATAA