Transcript asmbl_127343

Sequence
Transcript Sequence for observation asmbl_127343 of TGE0058527:
ACTTGAACTTATATTTTTTAACTAAAAATTAATAAAGTAAATCTATAATTGCTCAGTTAAGAAAAACAAACCCTTTTCTTTTCCTCTAGAGGAAATATGACTTGAGACAGGTTTGGGTAATTGATGGAAGAGAAGATTTCTCATAACAAAAATTAAACAAGCCACATAACAAACAGATGATGGGAAATTTCCATTCATCATTAAAAATATCCTTTATACATAAAACATATATTTTGCTGCCTAAATGCATCTTCCAGGTTGCAGAGGCAGAAATCTCAGGGCATGTCATGGTACATACCATGGTGTCAAGCCGACCGATGACTTCAAACGAAAAATCCACACCTCCATCAGTCATTTCCTTTAGCACTTCCTGAATGGGTTTCTTGTAGTCTTGAGGGTTGATGCATTCAGTGGCACCCAACTCTTTGGCCTTTGCAAATTTGTCCTTGTTGATGTCCACCGCAATGATTCTGGCTGC