Transcript asmbl_12637

Sequence
Transcript Sequence for observation asmbl_12637 of TGE0058522:
CCAGACCCACGGCTCCCTGCTGAGACTCTACCAAGCGTCCCCCGCCGACTCGGGCGAGTACGTGTGCCGAGTGTTGGGCAGCTCCGTGCCTCTAGAGGCCTCTGTCCTGGTCACCATTGAGCCTGCGGGCTCAGTGCCTGCACTTGGGGTCACCCCCACGGTCCGGATCGAGTCATCGTCTTCGCAAGTGGCCGAGGGGCAGACCCTGGACCTGAACTGCCTCGTTGCTGGTCAGGCCCATGCCCAGGTCACGTGGTACAAGCGCGGGGGCAGCCTCCCCGCCCGGCACCAGACCCATGGCTCCCAGCTGCGGCTCCACCTCGTCTCCCCTGCCGACTCAGGCGAGTATGTGTGTCGTGCAGCCAGCGGCCCAGGCCCTGAGCAAGAAGCCTCCTTCACAGTCACCGTCCCGCCCAGTGAGGGGTCTTCCTACCGCCTTAGGAGCCCGGTCATCTCCATCGACCCGCCCAGCAGCACCGTGCAGCAGGGCCAGGATGCCAGCTTCAAGTGCCTCATCCATGACGGGGCAGCCCCCATCAGCCTCGAGTGGAAGACCCGGAACCAGGAGCTGGAGGACAACGTCCACATCAGTCCCAATGGCTCCATCATCACCATCGTGGGCACCCGGCCCAGCAACCACGGTACCTACCGCTGCGTGGCCTCCAATGCCTACGGTGTGGCCCAGAGTGTGGTGAACCTCAGTGTGCACGGGCCCCCTACAGTGTCCGTGCTCCCCGAGGGCCCCGTGTGGGTGAAAGTGGGAAAGGCTGTCACCCTGGAGTGTGTCAGTGCCGGGGAGCCCCGCTCCTCTGCTCGTTGGACCCGGATCAGCAGCACCCCTGCCAAGTTGGAGCAGCGGACATATGGGCTCATGGACAGCCACGCGGTGCTGCAGATTTCATCAGCTAAACCATCAGATGCGGGCACTTATGTGTGCCTTGCTCAGAATGCACTAGGCACAGCACAGAAGCAGGTGGAGGTGATCGTGGACACGGGCGCCATGGCCCCAGGGGCCCCTCAGGTCCAAGCTGAAGAAGCTGAGCTGACTGTGGAGGCTGGACACACGGCCACCTTGCGCTGCTCAGCCACAGGCAGCCCCGCGCCCACCATCCACTGGTCCAAGCTGCGTTCCCCACTGCCCTGGCAGCACCGGCTGGAAGGTGACACACTCATCATACCCCGGGTAGCCCAGCAGGACTCGGGCCAGTACATCTGCAATGCCACTAGCCCTGCTGGGCACGCTGAGGCCACCATCATCCTGCACGTGGAGAGCCCACCATATGCCACCACGGTCCCAGAGCACGCTTCGGTGCAGGCAGGGGAGACGGTGCAGCTCCAGTGCCTGGCTCACGGGACACCCCCACTCACCTTCCAGTGGAGCCGCGTGGGCAGCAGCCTTCCTGGGAGGGCGACCGCCAGGAACGAGCTGCTGCACTTTGAGCGTGCAGCCCCTGAGGACTCAGGCCGCTACCGCTGCCGGGTCACCAACAAGGTGGGCTCAGCCGAGGCCTTTGCCCAGCTGCTCGTCCAAGGCCCTCCCGGCTCTCTCCCTGCCACCTCCATCCCAGCAGGGTCCACGCCCACCGTGCAGGTCACGCCTCAGCTAGAGACCAAGAGCATTGGGGCCAGCGTTGAGTTCCACTGTGCTGTGCCCAGCGACCGGGGTACCCAGCTCCGTTGGTTCAAGGAAGGGGGTCAGCTGCCTCCGGGTCACAGCGTGCAGGATGGGGTGCTCCGAATCCAGAACTTGGACCAGAGCTGCCAAGGGACGTATATATGCCAGGCCCATGGACCTTGGGGGAAGGCCCAGGCCAGTGCCCAGCTGGTTATCCAAGCCCTGCCCTCGGTGCTCATCAACATCCGGACCTCTGTGCAGACCGTGGTGGTTGGCCACGCCGTGGAGTTCGAATGCCTGGCACTGGGTGACCCCAAGCCTCAGGTGACATGGAGCAAAGTTGGAGGGCACCTGCGGCCAGGCATTGTGCAGAGCGGAGGTGTCGTCAGGATCGCCCACGTAGAGCTGGCTGATGCGGGACAGTATCGCTGCACTGCCACCAACGCAGCTGGCACCACACAATCCCACGTCCTGCTGCTTGTGCAAGCCTTGCCCCAGATCTCAATGCCCCAAGAAGTCCGTGTGCCTGCTGGTTCTGCAGCTGTCTTCCCCTGCATAGCCTCAGGCTACCCCACTCCTGACATCAGCTGGAGCAAGCTGGATGGCAGCCTGCCACCTGACAGCCGCCTGGAGAACAACATGCTGATGCTGCCCTCAGTCCGACCCCAGGACGCAGGTACCTACGTCTGCACCGCCACTAACCGCCAGGGCAAGGTCAAAGCCTTTGCCCACCTGCAGGTGCCAGAGCGGGTGGTGCCCTACTTCACGCAGACCCCCTACTCCTTCCTACCGCTGCCCACCATCAAGGATGCCTACAGGAAGTTCGAGATCAAGATCACCTTCCGGCCCGACTCAGCCGATGGTGAGCAGGAGGGTTAATTTGCGGGGTGGGCTGGCCTGGGTTGAGGGACC