Transcript asmbl_12636

Sequence
Transcript Sequence for observation asmbl_12636 of TGE0058521:
CCAGACCCACGGCTCCCTGCTGAGACTCTACCAAGCGTCCCCCGCCGACTCGGGCGAGTACGTGTGCCGAGTGTTGGGCAGCTCCGTGCCTCTAGAGGCCTCTGTCCTGGTCACCATTGAGCCTGCGGGCTCAGTGCCTGCACTTGGGGTCACCCCCACGGTCCGGATCGAGTCATCGTCTTCGCAAGTGGCCGAGGGGCAGACCCTGGACCTGAACTGCCTCGTTGCTGGTCAGGCCCATGCCCAGGTCACGTGGCACAAGCGCGGGGGCAGCCTCCCGGCCCGGCACCAGACCCATGGCTCCCAGCTGCGGCTCCACCTCGTCTCCCCTGCCGACTCAGGCGAGTATGTGTGTCGTGCAGCCAGCGGCCCAGGCCCTGAGCAAGAAGCCTCCTTCACAGTCACCGTCCCGCCCAGTGAGGGGTCTTCCTACCGCCTTAGGAGCCCGGTCATCTCCATCGACCCGCCCAGCAGCACCGTGCAGCAGGGCCAGGATGCCAGCTTCAAGTGCCTCATCCATGACGGGGCAGCCCCCATCAGCCTCGAGTGGAAGACCCGGAACCAGGAGCTGGAGGACAACGTCCACATCAGTCCCAATGGCTCCATCATCACCATCGTGGGCACCCGGCCCAGCAACCACGGTACCTACCGCTGCGTGGCCTCCAATGCCTACGGTGTGGCCCAGAGTGTGGTGAACCTCAGTGTGCACGGGCCCCCTACAGTGTCCGTGCTCCCCGAGGGCCCCGTGTGGGTGAAAGTGGGAAAGGCTGTCACCCTGGAGTGTGTCAGTGCCGGGGAGCCCCGCTCCTCTGCTCGTTGGACCCGGATCAGCAGCACCCCTGCCAAGTTGGAGCAGCGGACATATGGGCTCATGGACAGCCACGCGGTGCTGCAGATTTCATCAGCTAAACCATCAGATGCGGGCACTTATGTGTGCCTTGCTCAGAATGCACTAGGCACAGCACAGAAGCAGGTGGAGGTGATCGTGGACACGGGCGCCATGGCCCCAGGGGCCCCTCAGGTCCAAGCTGAAGAAGCTGAGCTGACTGTGGAGGCTGGACACACGGCCACCTTGCGCTGCTCAGCCACAGGCAGCCCCGCGCCCACCATCCACTGGTCCAAGCTGCGTTCCCCACTGCCCTGGCAGCACCGGCTGGAAGGTGACACACTCATCATACCCCGGGTAGCCCAGCAGGACTCGGGCCAGTACATCTGCAATGCCACTAGCCCTGCTGGGCACGCTGAGGCCACCATCATCCTGCACGTGGAGAGTAAGGCCTCATCCCTTCTTTGTCTGCACCA