Transcript asmbl_12635

Sequence
Transcript Sequence for observation asmbl_12635 of TGE0058520:
CCAGACCCACGGCTCCCTGCTGAGACTCTACCAAGCGTCCCCCGCCGACTCGGGCGAGTACGTGTGCCGAGTGTTGGGCAGCTCCGTGCCTCTAGAGGCCTCTGTCCTGGTCACCATTGAGCCTGCGGGCTCAGTGCCTGCACTTGGGGTCACCCCCACGGTCCGGATCGAGTCATCGTCTTCGCAAGTGGCCGAGGGGCAGACCCTGGACCTGAACTGCCTCGTTGCTGGTCAGGCCCATGCCCAGGTCACGTGGTACAAGCGCGGGGGCAGCCTCCCCGCCCGGCACCAGACCCATGGCTCCCAGCTGCGGCTCCACCTCGTCTCCCCTGCCGACTCAGGCGAGTATGTGTGTCGTGCAGCCAGCGGCCCAGGCCCTGAGCAAGAAGCCTCCTTCACAGTCACCGTCCCGCCCAGTGAGGGGTCTTCCTACCGCCTTAGGAGCCCGGTCATCTCCATCGACCCGCCCAGCAGCACCGTGCAGCAGGGCCAGGATGCCAGCTTCAAGTGCCTCATCCATGACGGGGCAGCCCCCATCAGCCTCGAGTGGAAGACCCGGAACCAGGAGCTGGAGGACAACGTCCACATCAGTCCCAATGGCTCCATCATCACCATCGTGGGCACCCGGCCCAGCAACCACGGTACCTACCGCTGCGTGGCCTCCAATGCCTACGGTGTGGCCCAGAGTGTGGTGAACCTCAGTGTGCACGGGCCCCCTACAGTGTCCGTGCTCCCCGAGGGCCCCGTGTGGGTGAAAGTGGGAAAGGCTGTCACCCTGGAGTGTGTCAGTGCCGGGGAGCCCCGCTCCTCTGCTCGTTGGACCCGGATCAGCAGCACCCCTGCCAAGTTGGAGCAGCGGACATATGGGCTCATGGACAGCCACGCGGTGCTGCAGATTTCATCAGCTAAACCATCAGATGCGGGCACTTATGTGTGCCTTGCTCAGAATGCACTAGGCACAGCACAGAAGCAGGTGGAGGTGATCGTGGACACGGGCGCCATGGCCCCAGGGGCCCCTCAGGTCCAAGCTGAAGAAGCTGAGCTGACTGTGGAGGCTGGACACACGGCCACCTTGCGCTGCTCAGCCACAGGCAGCCCCGCGCCCACCATCCACTGGTCCAAGCTGCGTTCCCCACTGCCCTGGCAGCACCGGCTGGAAGGTGACACACTCATCATACCCCGGGTAGCCCAGCAGGACTCGGGCCAGTACATCTGCAATGCCACTAGCCCTGCTGGGCACGCTGAGGCCACCATCATCCTGCACGTGGAGAGTAAGGCCTCATCCCTTCTTTGTCTGCACCA