Transcript asmbl_12631

Sequence
Transcript Sequence for observation asmbl_12631 of TGE0058519:
ACCCAGAGACTGGGGCCTGCTCGCAATGCCAGCACAACGCCGCAGGGGAGTTCTGCGAGCTTTGTGCCCCTGGCTACTACGGAGATGCCACAGCCGGGACGCCTGAGGACTGCCAGCCCTGTGCCTGCCCACTGACCAACCCAGAGAACATGTTTTCCCGCACCTGTGAGAGCCTGGGAGCCGGCGGGTACCGCTGCACGGCCTGCGAACCCGGCTACACTGGCCAGTACTGTGAGCAGTGTGGCCCAGGTTACGTGGGTAACCCCAGTGTGCAAGGGGGCCAGTGCCTGCCAGAGACAAACCAAGCCCCACTGGTGGTCGAGGTCCATCCTGCTCGAAGCATAGTGCCCCAAGGTGGCTCCCACTCCCTGCGGTGTCAGGTCAGTGGGAGCCCACCCCACTACTTCTATTGGTCCCGTGAGGATGGGCGGCCTGTGCCCAGCGGCACCCAGCAGCGACATCAAGGCTCCGAGCTCCACTTCCCCAGCGTCCAGCCCTCGGATGCTGGGGTCTACATTTGCACCTGCCGTAATCTCCACCAATCCAATACCAGCCGGGCAGAGCTGCTGGTCACTGAGGCTCCAAGCAAGCCCATCACAGTGACTGTGGAGGAGCAGCGGAGCCAGAGCGTGCGCCCCGGAGCTGACGTCACCTTCATCTGCACAGCCAAAAGCAAGTCCCCAGCCTATACCCTGGTGTGGACCCGCCTGCACAACGGGAAACTGCCCACCCGAGCCATGGATTTCAATGGCATCCTGACCATTCGCAACGTCCAGCTGAGTGATGCAGGCACCTACGTGTGCACCGGCTCCAACATGTTTGCCATGGACCAGGGCACAGCCACTCTACATGTGCAGGCCTCGGGCACCTTGTCCGCCCCCGTGGTCTCCATCCATCCGCCACAGCTCACAGTGCAGCCCGGGCAACTGGCGGAGTTCCGCTGCAGCGCCACAGGGAGCCCCACGCCCACCCTCGAGTGGACAGGGGGCCCCGGCGGCCAGCTCCCTGCGAAGGCACAAATCCACGGCGGCATCCTGCGCCTGCCAGCTGTCGAGCCCACGGATCAGGCCCAGTACTTGTGCCGAGCCCACAGCAGCGCTGGGCAGCAGGTGGCCAGGGCTGTGCTCCACGTGCATGGGGGCGGTGGGCCCAGAGTCCAAGTGAGCCCAGAGAGGACCCAGGTCCACGCAGGCCGCACCGTCAGGCTGTACTGCAGGGCTGCAGGCGTGCCTAGCGCCACCATCACCTGGAGGAAGGAAGGGGGCAGCCTCCCACCACAGGCCCGGTCAGAGCGCACAGACATCGCGACACTGCTCATCCCAGCCATCACGACTGCTGACGCCGGCTTCTACCTCTGCGTGGCCACCAGCCCTGCAGGCACTGCCCAGGCCCGGATCCAAGTGGTTGTCCTTTCAGCCTCAGATGCCAGCCCACCGCCGGTCAAGATTGAGTCCTCATCGCCTTCTGTGACAGAAGGGCAAACACTCGACCTCAACTGTGTGGTGGCAGGGTCAGCCCATGCCCAGGTCACCTGGTACAGGCGAGGGGGTAGCCTGCCTCCCCACACCCAGGTGCACGGCTCCCGTCTGCGGCTCCCCCAGGTCTCACCAGCTGATTCTGGAGAATATGTGTGCCGTGTGGAGAATGGATCGGGCCCCAAGGAGGCCTCCATTACTGTGTCTGTGCTCCACGGCACCCATTCTGGCCCCAGCTACACCCCAGTGCCCGGCAGCACCCGGCCCATCCGCATCGAGCCCTCCTCCTCACACGTGGCGGAAGGGCAGACCCTGGATCTGAACTGCGTGGTGCCCGGGCAGGCCCATGCCCAGGTCACGTGGCACAAGCGCGGGGGCAGCCTCCCGGCCCGGCACCAGGTGCATGGCTCGAGGCTACGCCTGCTCCAGGTGACCCCAGCTGATTCAGGGGAGTACGTGTGCCGTGTGGTCGGCAGCTCAGGTACCCAGGAAGCCTCAGTCCTTGTCACCATCCAGCAGCGCCTTAGTGGCTCCCACTCCCAGGGTGTGGCGTACCCCGTCCGCATCGAGTCCTCCTCAGCCTCCCTGGCCAATGGACACACCCTGGACCTCAACTGCCTGGTTGCCAGCCAGGCTCCCCACACCATCACCTGGTATAAGCGTGGAGGCAGCTTACCCAGCCGGCACCAGATCGTGGGCTCCCGGCTGCGGATCCCTCAGGTGACTCCGGCAGACTCGGGCGAGTACGTGTGTCACGTCAGTAACGGTGCAGGCTCCCGGGAGACCTCGCTCATCGTCACCATCCAGGGCAGCGGTTCCTCCCACGTGCCCAGCGTCTCCCCACCGATCAGGATCGAGTCGTCTTCCCCCACGGTGGTGGAAGGGCAGACCTTGGATCTGAACTGCGTGGTCGCCAGGCAGCCCCAGGCTATCATCACATGGTACAAGCGTGGGGGCAGCCTTCCCTCCCGACACCAGACCCATGGCTCCCACCTGCGGTTGCACCAAATGTCTGTGGCTGACTCGGGCGAGTATGTGTGCCGGGCCAACAACAACATCGATGCCCTGGAGGCCTCCATCGTCATCTCCGTCTCCCCTAGCGCCGGCAGCCCCTCCGCCCCTGGCAGCTCCATGCCCATCAGAATTGAGTCATCCTCCTCACACGTGGCCGAAGGGG