Transcript asmbl_12629

Sequence
Transcript Sequence for observation asmbl_12629 of TGE0058518:
GAGTGAGTAAATGCATAAGACCTGACAAGTGAGTGTGTTTGTGAGTGAATGCATGAAAAAGTGAATGAGGAGTGAATGAATGCTGGAGCTTCAGTGCTCACCTTTCCTTGGGCAGTCTATGGCCTCCCTCGGGCCAGGCCTGCAGTGACTGATCTCACTGGACCTCTGCCTCCCTCCTCCCCAGCCCTGCCCTCGGTGCTCATCAACATCCGGACCTCTGTGCAGACCGTGGTGGTTGGCCACGCCGTGGAGTTCGAATGCCTGGCACTGGGTGACCCCAAGCCTCAGGTGACATGGAGCAAAGTTGGAGGGCACCTGCGGCCAGGCATTGTGCAGAGCGGAGGTGTCGTCAGGATCGCCCACGTAGAGCTGGCTGATGCGGGACAGTATCGCTGCACTGCCACCAACGCAGCTGGCACCACACAATCCCACGTCCTGCTGCTTGTGCAAGCCTTGCCCCAGATCTCAATGCCCCAAGAAGTCCGTGTGCCTGCTGGTTCTGCAGCTGTCTTCCCCTGCATAGCCTCAGGCTACCCCACTCCTGACATCAGCTGGAGCAAGCTGGATGGCAGCCTGCCACCTGACAGCCGCCTGGAGAACAACATGCTGATGCTGCCCTCAGTCCGACCCCAGGACGCAGGTACCTACGTCTGCACCGCCACTAACCGCCAGGGCAAGGTCAAAGCCTTTGCCCACCTGCAGGTGCCAGAGCGGGTGGTGCCCTACTTCACGCAGACCCCCTACTCCTTCCTACCGCTGCCCACCATCAAGGATGCCTACAGGAAGTTCGAGATCAAGATCACCTTCCGGCCCGACTCAGCCGATGGGATGCTGCTGTACAATGGGCAGAAGCGAGTCCCAGGGAGCCCCACCAACCTGGCCAACCGGCAGCCCGACTTCATCTCCTTCGGCCTCGTGGGGGGAAGGCCCGAGTTCCGGTTCGATGCAGGCTCAGGCATGGCCACCATCCGCCATCCCACACCACTGGCCCTGGGCCATTTCCACACCGTGACCCTGCTGCGCAGCCTCACCCAGGGCTCCCTGATTGTGGGTGACCTGGCCCCGGTCAATGGGACCTCCCAGGGCAAGTTCCAGGGCCTGGATCTGAACGAGGAACTCTACCTGGGTGGCTATCCTGACTATGGTGCCATCCCCAAGGCGGGGCTGAGCAGCGGCTTCATAGGCTGTGTCCGGGAGCTGCGCATCCAGGGCGAGGAGATCGTCTTCCATGACCTCAACCTCACGGCGCACGGCATCTCCCACTGCCCCACCTGTCGGGACCGGCCCTGCCAGAATGGCGGTCAGTGCCATGACTCTGAGAGCAGCAGCTACGTGTGCGTCTGCCCAGCTGGCTTCACCGGGAGCCGCTGTGAGCACTCGCAGGCCCTGCACTGCCATCCAGAGGCCTGTGGGCCCGACGCCACCTGTGTGAACCGGCCTGACGGTCGAGGCTACACCTGCCGCTGCCACCTGGGCCGCTCGGGGTTGCGGTGTGAGGAAGGTGTGACAGTGACCACCCCCTCGCTGTCGGGTGCTGGCTCCTACCTGGCACTGCCCGCCCTCACCAACACACACCACGAGCTACGCCTGGACGTGGAGTTCAAGCCACTCGCCCCTGACGGGGTCCTGCTGTTCAGCGGGGGGAAGAGCGGGCCTGTGGAGGACTTCGTGTCCCTGGCGATGGTGGGCGGCCACCTGGAGTTCCGCTATGAGTTGGGGTCAGGGCTGGCCGTTCTGCGGAGCGCCGAGCCGCTGGCCCTGGGCCGCTGGCACCGTGTGTCTGCAGAGCGTCTCAACAAGGACGGCAGCCTGCGGGTGAATGGTGGACGCCCTGTGCTGCGCTCCTCGCCCGGCAAGAGCCAGGGCCTCAACCTGCACACCCTGCTCTACCTGGGGGGTGTGGAGCCTTCCGTGCCACTGTCCCCGGCCACCAACATGAGCGCTCACTTCCGCGGCTGTGTGGGCGAGGTGTCAGTGAATGGCAAACGGCTGGACCTCACCTACAGTTTCCTAGGCAGCCAGGGCATCGGGCAATGCTATGATAGCTCCCCATGTGAGCGCCAGCCTTGCCAACATGGTGCCACGTGCATGCCCGCTGGCGAGTATGAGTTCCAGTGCCTGTGTCGAGATGGATTCAAAGGAGACCTGTGTGAGCACGAGGAGAACCCCTGCCAGCTCCGTGAACCCTGTCTGCATGGGGGCACCTGCCAGGGCACCCGCTGCCTCTGCCTCCCTGGCTTCTCTGGCCCACGCTGCCAACAAGGCTCTGGACATGGCATAGCAGAGTCCGACTGGCATCTTGAAGGCAGCGGGGGCAATGATGCCCCTGGGCAGTACGGAGCCTATTTCCACGATGATGGCTTCCTCGCCTTCCCTGGCCATGTCTTCTCCAGGAGCCTGCCCGAGGTGCCCGAGACCATCGAGCTGGAGGTTCGGACCAGCACAGCCAGTGGCCTCCTGCTCTGGCAGGGTGTGGAGGTGGGAGAGGCCGGCCAAGGCAAGGACTTCATCAGCCTCGGGCTTCAAGACGGGCACCTTGTCTTCAGGTACCAGCTGGGTAGTGGGGAGGCCCGCCTGGTCTCTGAGGACCCCATCAATGACGGCGAGTGGCACCGGGTGACAGCACTGCGGGAGGGCCGCAGAGGTTCCATCCAAGTCGACGGTGAGGAGCTGGTCAGCGGCCGGTCCCCAGGTCCCAACGTGGCAGTCAACGCCAAGGGCAGCGTCTACATCGGCGGAGCCCCTGACGTGGCCACGCTGACCGGGGGCAGATTCTCCTCAGGCATCACAGGCTGTGTCAAGAACCTGGTGCTGCACTCGGCCCGACCCGGCGCCCCGCCCCCACAGCCCCTGGACCTGCAGCACCGCGCCCAGGCCGGGGCCAACACACGCCCCTGCCCCTCGTAGGCACCTGCCTGCCCCACACGGACTCCCGGGCCACGCCCCAGCCCGACAATGTCGAGTATATTATTATTAATATTATTATGAATTTTTGTAAGAAACCGAGGCGATGCCACGCTTTGCTGCTACCGCCCTGGGCTGGACTGGAGGTGGGCATGCCACCCTCACACACACAGCTGGGCAAAGCCACAAGGCTGGCCAGCAAGGCAGGTTGGATGGGAGTGGGCACCTCAGAAAGTCACCAGGACTTGGGGTCAGGAACAGTGGCTGGGTGGGCCCAGAACTGCCCCCACTGTCCCCCTACCCACCGATGGAGCCCCCAGATAGAGCTGGGTGGCCTGTTTCTGCAGCCCTTGGGCAGTTCTCACTCCTAGGAGAGCCAACCTCGGCTTGTGGGCTGGTGCCCCACAGCTACCTGAGACGGGCATCGCAGGAGTCTCTGCCACCCACTCAGGATTGGGAATTGTCTTTAGTGCCGGCTGTGGAGCAAAAGGCAGCTCACCCCTGGGCAGGCGGTCCCCATCCCCACCAGCTCGTTTTTCAGCACCCCCACCCACCTCCACCCAGCCCCTGGCACCTCCTCTGGCAGACTCCCCCTCCTACCACGTCCTCCTGGCCTGCATTCCCACCCCCTCCTGCCAGCACACAGCCTGGGGTCCCTCCCTCAGGGGCTGTAAGGGAAGGCCCACCCCAACTCTTACCAGGAGCTGCTACAGGCAGAGCCCAGCACTGATAGGGCCCCGCCCACCGGGCCCCGCCCACCCCAGGCCACATCCCCACCCATCTGGAAGTGAAGGCCCAGGGACTCCTCCAACAGACAACGGACGGACGGATGCCGCTGGTGCTCAGGAAGAGCTAGTGCCTTAGGTGGGGGAAGGCAGGACTCACGACTGAGAGAGAGAGGAGGGGGATATGACCACCCTGCCCCATCTGCAGGAGCCTGAAGATCCAGCTCAAGTGCCATCCTGCCAGTGGCCCCCAGACTGTGGGGTTGGGACGCCTGGCCTCTGTGTCCTAGAAGGGACCCTCCTGTGGTCTTTGTCTTGATTTTTCTTAATAAACGGTGCTATCCCCGCCAGGGGCCTCCTGAGTCTTTGATGAGGGCTTCACTCAGTGGAGCCTGTGGATGGGGCAGAGCAGGGCAGGTGAGATCTGGGGGTGAAGCAAGCTGGCTTGGGATCAGCGAGGCCCCCAGGCCCCCAACCCTGTGAGGCAGGAATTGTCCTATTTTCTAGAGGGGCAGCTGAGTCTCAGAGGGTTAGGGGGCCTGTCCAACATCAGACAGAGAGCCAGGGGGTTAGAACCCAAAGAGTCTGACCCCAGAGCCTAGTATCATTCCCATGTGCCCGAAGCCCCTCTAGGGATGGCCTCCCTGATCCTATAAGGCTGGGCCACTCAACTGCAGCCCCCTGGGGAGACCTGGCTGGGACATGGGTAGCACGTGGTACAGGCTGTGCTGCAGTGGAGGCAGAGGCCACGGGCACCAGGTTGCCAGGCCAGCCAGCTGGGAGAGCAACAGCACCAGAGGAGGCCCAGGAGGAGGCCAGCAGAGGCCAGGAGCATCGAGGAGGCCAGCGCCACCCCTCAGAGCTGGGGGCCTGTGGGAAGAGAAAGTCCACTCAGGCCTCGGCCTGGGTCCTCTGCCCCGTCCCCATCACCTAGAGAGGGACAGGTATGATTTTGGTGGGAAGAGTAGGAGCAAGGTGTAACCTTCCAAAGCTGCGTCTTGTCTCGTGGGGTCCCTGCCTGCTGGGGAACTCCTCTCAGCTGCAATCCAGAGGGATCCTGCAGACCCGAGAGCTGGGGAGGGAGTCAGGGATCTGGAGGTATGGGCATCTGTACTTCCTGTCTGGCTGGGCACCGGAGAGGGACCTGCATGGGAAAGAACAGAACTAGCACACTGAGAACTGCCCTTTCTGGGACACTTGTGTGTTTCATTCAATCCTCACAAGACTTCCCTGAGTTTGTCACTCTGTGTTTCCATTTTACAGAGAGGTTGTCACTTGCCGAGTTCAATTAGCTGGAAGTGATAGGAGGACTTGAACTCACATGGTCTGGCTCCAGGGCCTAAGGTCTATGAGTGGAGCTACTTCCCAAGGAAGAGGGTGTACATGTACTGAGCATTGAGGCAGGGTCTCACTCTGTCGCCCAGG