Transcript asmbl_124170

Sequence
Transcript Sequence for observation asmbl_124170 of TGE0056382:
GGGGTGACTTTGCTGCTGGCTGCCCATTGGCCTATCCTCCACCCTCTGCTCTCCTGAGAAGTCAAGTGTGGATTTTGTCTGCTAGTTACCTTTAGCCCAGTGGGCAGCAGCGTGGGGCTCGGCATGTGACTTGTGCCCTGAGAGACCTTGGTAGGCTGGGGGAGCGCAGCTGAGCCCTGCTAACCCCCGCCCACTTCCAGGCTCATTGCCCTCTTCTGTGTCTGCAGTGGGGTGTCACCTAGTAGTCAGCTGTTGGTGGCACAGATGAATTCAGCTTAGAGAACTATCAACACAGGACAATGCAAGCCCATGAGCTGTTCCGGTATTTTCGAATGCCAGAGCTGGTTGACTTCCGACAGTACGTGCGTACTCTTCCGACCAACACGCTTATGGGCTTCGGAGCTTTTGCAGCACTCACCACCTTCTGGTACGCCACGAGACCCAAACCCCTGAAGCCGCCATGCGACCTCTCCATGCAGTCAGTGGAAGTGGCGGGTAGTGGTGGTGCACGAAGATCCGCACTACTTGACAGCGACGAGCCCTTGGTGTATTTCTATGATGATGTCACAACATTATACGAAGGTTTCCAGAGGGGAATACAGGTGTCAAATAATGGCCCTTGTTTAGGCTCTCGGAAACCAGACCAACCCTATGAATGGCTTTCATATAAACAGGTTGCAGAATTGTCGGAGTGCATAGGCTCAGCACTGATCCAGAAGGGCTTCAAGACTGCCCCAGATCAGTTCATTGGCATCTTTGCTCAAAATAGACCTGAGTGGGTGATTATTGAACAAGGATGCTTTGCTTATTCGATGGTGATCGTTCCACTTTATGATACCCTTGGAAATGAAGCCATCACGTACATAGTCAACAAAGCTGAACTCTCTCTGGTTTTTGTTGACAAGCCAGAGAAGGCCAAACTCTTATTAGAGGGTGTAGAAAATAAGTTAATACCAGGCCTTAAAATCATAGTTGTCATGGATGCCTACGGCAGTGAACTGGTGGAACGAGGCCAGAGGTGTGGGGTGGAAGTCACCAGCATGAAGGCGATGGAGGACCTGGGAAGAGCCAACAGACGGAAGCCCAAGCCTCCAGCACCTGAAGATCTTGCAGTAATTTGTTTCACAAGTGGAACTACAGGCAACCCCAAAGGAGCAATGGTCACTCACCGAAACATAGTGAGCGATTGTTCAGCTTTTGTGAAAGCAACAGAGAATACAGTCAATCCTTGCCCAGATGATACTTTGATATCTTTCTTGCCTCTCGCCCATATGTTTGAGAGAGTTGTAGAGTGTGTAATGCTGTGTCATGGAGCTAAAATCGGATTTTTCCAAGGAGATATCAGGCTGCTCATGGATGACCTCAAGGTGCTTCAACCCACTGTCTTCCCCGTGGTTCCAAGACTGCTGAACCGGATGTTTGACCGAATTTTCGGACAAGCAAACACCACGCTGAAGCGATGGCTCTTGGACTTTGCCTCCAAGAGGAAAGAAGCAGAGCTTCGCAGCGGCATCATCAGAAACAACAGCCTGTGGGACCGGCTGATCTTCCACAAAGTACAGTCGAGCCTGGGCGGAAGAGTCCGGCTGATGGTGACAGGAGCCGCCCCGGTGTCTGCCACTGTGCTGACGTTCCTCAGAGCAGCCCTGGGCTGTCAGTTTTATGAAGGATACGGACAGACAGAGTGCACTGCCGGGTGCTGCCTGACCATGCCTGGAGACTGGACCGCAGGCCATGTTGGGGCCCCGATGCCGTGCAATTTGATAAAACTTGTTGATGTGGAAGAAATGAATTACATGGCTGCCGAGGGCGAGGGCGAGGTGTGTGTGAAAGGGCCAAATGTATTTCAGGGCTACTTGAAGGACCCAGCGAAAACAGCAGAAGCTTTGGACAAAGACGGCTGGTTACACACAGGGGACATTGGAAAATGGTTACCAAATGGCACCTTGAAAATTATCGACCGGAAAAAGCACATATTTAAGCTGGCACAAGGAGAATACATAGCCCCTGAAAAGATTGAAAATATCTACATGCGAAGTGAGCCTGTTGCTCAGGTGTTTGTCCACGGAGAAAGCCTGCAGGCATTTCTCATTGCAATTGTGGTACCAGATGTTGAGACATTATGTTCCTGGGCCCAAAAGAGAGGATTTGAAGGGTCGTTTGAGGAACTGTGCAGAAATAAGGATGTCAAAAAAGCTATCCTCGAAGATATGGTGAGACTTGGGAAGGATTCTGGTCTGAAACCATTTGAACAGGTCAAAGGCATCACATTGCACCCTGAATTATTTTCTATCGACAATGGCCTTCTGACTCCAACAATGAAGGCGAAAAGGCCAGAGCTGCGGAACTATTTCAGGTCGCAGATAGATGACCTCTATTCCACTATCAAGGTTTAGTGTGAAGAAGAAAGCTCAGAGGAAATGGCACAGTTCCACAATCTCTTCTCCTGCTGATGGCCTTCATGTTGTTAATTTTGAATACAGCAAGTGTAGGGAAGGAAGCGTTCGTGTTTGACTTGTCCATTCGGGGTTCTTCTCATAGGAATGCTAGAGGAAAGAGAACACTGCCTTACAGTCACCTCATGTTGCAGACCATGTTTATGGTAATACACACTTTCCAAAATGAGCCTTAAAAATTGTAAAGGGGATACTATAAATGTGCTAAGTTATTTGAGACTTCCTCAGTTTAAAAAGTGGGTTTTAAATCTTCTGTCTCCCTGTTTCTCTAATCAAGGGGTTAGGACTTTGCTATCTCTGAGATGTCTGCTACTTGCTGCAAATTCTGCAGCTGTCTGCTGCTCTAAAGAGTACAGTGCACTAGAGGGAAGTGTTCCCTTTAAAAATAAGAACAACTGTCCTGGCTGGAGAATCTCACAAGCGGACCAGAGATCTTTTTAAATCCCTGCTACTGTCCCTTCTCACAGGCATTCACAGAACCCTTCTGATTCGTAAGGGTTACGAAACTCATGTTCTTCTCCAGTCCCCTGTGGTTTCTGTTGGAGCATAAGGTTTCCAGTAAGCGGGAGGGCAGATCCAACTCAGAACCATGCAGATAAGGAGCCTCTGGCAAATGGGTGCTCATCAGAACGCGTGGATTCTCTTTCATGGCAGAATGCTCTTGGACTCGGTTCTCCAGGCCTGATTCCCCGACTCCATCCTTTTTCAGGGGTTATTTAAAAATCTGCCTTAGATTCTATAGTGAAGACAAGCATTTCAAGAAAGAGTTACCTGGATCAGCCATGCTCAGCTGTGACGCCTGAATAACTGTCTACTTTATCTTCACTGAACCACTCACTCTGTGTAAAGGCCAACAGATTTTTAATGTGGTTTTCATATCAAAAGATCATGTTGGGATTAACTTGCCTTTTTCCCCAAAAAATAAACTCTCAGGCAAGCATTTCTTTAAAGCTATTAAGGGAGTATATACTTGAGTACTTATTGAAATGGACAGTAATAAGCAAATGTTCTTATAATGCTACCTGATTTCTATGAAATGTGTTTGACAAGCCAAAATTCTAGGATGTAGAAATCTGGAAAGTTCATTTCCTGGGATTCACTTCTCCAGGGATTTTTTAAAGTTAATTTGGGAAATTAACAGCAGTTCACTTTATTGTGAGTCTTTGCCACATTTGACTGAATTGAGCTGTCATTTGTACATTTAAAGCAGCTGTTTTGGGGTCTGTGAGAGTACATGTATTATATACAAGCACAACAGGGCTTGCACTAAAGAATTGTCATTGTAATAACACTACTTGGTAGCCTAACTTCATATATGTATTCTTAATTGCACAAAAAGTCAATAATTTGTCACCTTGGGGTTTTGAATGTTTGCTTTAAGTGTTGGCTATTTCTATGTTTTATAAACCAAAACAAAATTTCCAAAAACAATGAAGGAAACCAAAATAAATATTTCTGCATTTCAGGTGAGTGAGGCATCTTTTTTAATGTCATGTTTAATATTCGGAACAGCCTGTAATGTGCACAAGCGAAGAGCAAGAATGGCCCTGGGCCTGGAATCCTTCCCAGTTGTCTTCTTTTCTTCTTAGTCACCCTCCTCTAACTCAGCTGGC