Transcript asmbl_124166

Sequence
Transcript Sequence for observation asmbl_124166 of TGE0057121:
GCAGCATCCTGGCTCAGCCGCGGCGGTGGCGGGGGCGCAACCAGCGGGCCGAGGCGGCGGCGCCAGCGGCGCCTTAAATAGCATCCAGAGCCGGCGCGGGGCAGGGAGTGGGCTGCAGTGACAGCCGGCGGCGGAGCGGCCGGTCCACGGAGGAGAATTCAGCTTAGAGAACTATCAACACAGGACAATGCAAGCCCATGAGCTGTTCCGGTATTTTCGAATGCCAGAGCTGGTTGACTTCCGACAGTACGTGCGTACTCTTCCGACCAACACGCTTATGGGCTTCGGAGCTTTTGCAGCACTCACCACCTTCTGGTACGCCACGAGACCCAAACCCCTGAAGCCGCCATGCGACCTCTCCATGCAGTCAGTGGAAGTGGCGGGTAGTGGTGGTGCACGAAGATCCGCACTACTTGACAGCGACGAGCCCTTGGTGTATTTCTATGATGATGTCACAACATTATACGAAGGTTTCCAGAGGGGAATACAGGTGTCAAATAATGGCCCTTGTTTAGGCTCTCGGAAACCAGACCAACCCTATGAATGGCTTTCATATAAACAGGTTGCAGAATTGTCGGAGTGCATAGGCTCAGCACTGATCCAGAAGGGCTTCAAGACTGCCCCAGATCAGTTCATTGGCATCTTTGCTCAAAATAGACCTGAGTGGGTGATTATTGAACAAGGATGCTTTGCTTATTCGATGGTGATCGTTCCACTTTATGATACCCTTGGAAATGAAGCCATCACGTACATAGTCAACAAAGCTGAACTCTCTCTGGTTTTTGTTGACAAGCCAGAGAAGGCCAAACTCTTATTAGAGGGTGTAGAAAATAAGTTAATACCAGGCCTTAAAATCATAGTTGTCATGGATGCCTACGGCAGTGAACTGGTGGAACGAGGCCAGAGGTGTGGGGTGGAAGTCACCAGCATGAAGGCGATGGAGGACCTGGGAAGAGCCAACAGACGGAAGCCCAAGCCTCCAGCACCTGAAGATCTTGCAGTAATTTGTTTCACAAGTGGAACTACAGGCAACCCCAAAGGAGCAATGGTCACTCACCGAAACATAGTGAGCGATTGTTCAGCTTTTGTGAAAGCAACAGAGAATACAGTCAATCCTTGCCCAGATGATACTTTGATATCTTTCTTGCCTCTCGCCCATATGTTTGAGAGAGTTGTAGAGTGTGTAATGCTGTGTCATGGAGCTAAAATCGGATTTTTCCAAGGAGATATCAGGCTGCTCATGGATGACCTCAAGGTGCTTCAACCCACTGTCTTCCCCGTGGTTCCAAGACTGCTGAACCGGATGTTTGACCGAATTTTCGGACAAGCAAACACCACGCTGAAGCGATGGCTCTTGGACTTTGCCTCCAAGAGGAAAGAAGCAGAGCTTCGCAGCGGCATCATCAGAAACAACAGCCTGTGGGACCGGCTGATCTTCCACAAAGTACAGTCGAGCCTGGGCGGAAGAGTCCGGCTGATGGTGACAGGAGCCGCCCCGGTGTCTGCCACTGTGCTGACGTTCCTCAGAGCAGCCCTGGGCTGTCAGTTTTATGAAGGATACGGACAGACAGAGTGCACTGCCGGGTGCTGCCTGACCATGCCTGGAGACTGGACCGCAGGCCATGTTGGGGCCCCGATGCCGTGCAATTTGATAAAACTTGTTGATGTGGAAGAAATGAATTACATGGCTGCCGAGGGCGAGGGCGAGGTGAGTGAAAACCGTCAGTCATTTTCCCTCGCTGCCATTTCCTGTGATCGCTGGCCTTTGCGAATGCTGTGGTATTTCCCAACAGCTCAATAAAGCCATTGAACTTGACTTCATTGGTGATCCTGGAGTCTGCCAGGCTTCTTTCTGAGGGTACATTTATGTTCAGCTCTCGGGGAGTGGGCAGGAGGGACACTGATGCCTGTCTTCCTCTGCCAGGCCTCATAGGGATTTGGGCTGGAGAGCCTGCAAAGAAAGGCCCGGTGGCCTCAGTTCCTGGGACGAAGGTCCTGCCTGTTGATTGCCCTGGGTACCTATTAGTGAGCTGCTGGCTGCTGGATGGGAAGCCTAATTACTTAAAAGTGATTTCATCCCCTGCGGGGCTTTCCAACAGCTTTGAGCCAGAACCTAGGGCAAGCATTTGCCCTACAAATCGGCCAGAGCTGAGGTAATTCAGGAAGGGAAGTAGGGGCACTGGAGATCTCTCGCAGACCCTGGTGGGGCTCTGGTAACTCCCTCTGCATCCTGGAGTTTAGGGCTTCCAGCTAAAGGTTGGGGCAGACACACACGTACACACATGCACACACCAGTTTTCTCTGGAAAAACCCCAGTAAATGCTGTTCACTGATGATCTTCTTTTCTTTAGGTGTGTGTGAAAGGGCCAAATGTATTTCAGGGCTACTTGAAGGACCCAGCGAAAACAGCAGAAGCTTTGGACAAAGACGGCTGGTTACACACAGGGGACATTGGAAAATGGTTACCAAATGGCACCTTGAAAATTATCGACCGGAAAAAGCACATATTTAAGCTGGCACAAGGAGAATACATAGCCCCTGAAAAGATTGAAAATATCTACATGCGAAGTGAGCCTGTTGCTCAGGTGTTTGTCCACGGAGAAAGCCTGC