Transcript asmbl_124164

Sequence
Transcript Sequence for observation asmbl_124164 of TGE0058515:
GCAGCATCCTGGCTCAGCCGCGGCGGTGGCGGGGGCGCAACCAGCGGGCCGAGGCGGCGGCGCCAGCGGCGCCTTAAATAGCATCCAGAGCCGGCGCGGGGCAGGGAGTGGGCTGCAGTGACAGCCGGCGGCGGAGCGGCCGGTCCACGGAGGAGAATTCAGCTTAGAGAACTATCAACACAGGACAATGCAAGCCCATGAGCTGTTCCGGTATTTTCGAATGCCAGAGCTGGTTGACTTCCGACAGTACGTGCGTACTCTTCCGACCAACACGCTTATGGGCTTCGGAGCTTTTGCAGCACTCACCACCTTCTGGTACGCCACGAGACCCAAACCCCTGAAGCCGCCATGCGACCTCTCCATGCAGTCAGTGGAAGTGGCGGGTAGTGGTGGTGCACGAAGATCCGCACTACTTGACAGCGACGAGCCCTTGGTGTATTTCTATGATGATGTCACAACATTATACGAAGGTTTCCAGAGGGGAATACAGGTGTCAAATAATGGCCCTTGTTTAGGCTCTCGGAAACCAGACCAACCCTATGAATGGCTTTCATATAAACAGGTTGCAGAATTGTCGGAGTGCATAGGCTCAGCACTGATCCAGAAGGGCTTCAAGACTGCCCCAGATCAGTTCATTGGCATCTTTGCTCAAAATAGACCTGAGTGGGTGATTATTGAACAAGGATGCTTTGCTTATTCGATGGTGATCGTTCCACTTTATGATACCCTTGGAAATGAAGCCATCACGTACATAGTCAACAAAGCTGAACTCTCTCTGGTTTTTGTTGACAAGCCAGAGAAGGCCAAACTCTTATTAGAGGGTGTAGAAAATAAGTTAATACCAGGCCTTAAAATCATAGTTGTCATGGATGCCTACGGCAGTGAACTGGTGGAACGAGGCCAGAGGTGTGGGGTGGAAGTCACCAGCATGAAGGCGATGGAGGACCTGGGAAGAGCCAACAGACGGAAGCCCAAGCCTCCAGCACCTGAAGATCTTGCAGTAATTTGTTTCACAAGTGGAACTACAGGCAACCCCAAAGGAGCAATGGTCACTCACCGAAACATAGTGAGCGATTGTTCAGCTTTTGTGAAAGCAACAGAGAAAGCACTTCCCTTGAGTGCCAGTGACACACACATTTCATATTTACCACTTGCTCACATTTATGAACAGTTATTGAAGGTAAGTGTGGCGTGCGGACTGTCATCCCTATAGAGAATTCTCTGCTCAGCCCCGTTTTAGAAATGGTGCAGATTATTTGAAAGAATATAAATTCTTTTTCTGAGTATGAACAGGATACTGGAATTTAATCACTCATTTTAAAATTAGGAGTTCAGACTTTTGAAGGATACTAATGTGGACATGAGTCCAGAAAAACCAACTATAAAGGTAAAGTCATTATTAATTCAGTTCTACAAAGCCCAGCGAGGCTTCCGTTCTGTGAGAAGTCTCTATTTTTGATTGTGCTTGTTCCTAATGCACAAGTTGGCTTGCGACTAATTTTTTCAGCAATATTCTAAGTGCCCTTGGAGAAAGAGGATGATCCTTGAGTTGACCTTTGCCTAGGCTCCCTGTAATCAACTGTGTGACTAATTTTAAAACTGACCAAGAACCACCTTTTTTCCTTCTTTGACAATTTTGGATTTTATGCTGTAGGAAAAAACAATGAGCACCATTCATTCATTTAGTGAGTAGTTACTGAGCTCTAGCTGTGTGCCCTCTGCTGTGTTGGAGACAGAGGTGACTATCAGCCGATGCTTTGGATGACAGCTGCCCTGTCGGATTTGCTCATCCCAAAGGATCGAAGGCGATTAGATCCCATCTGCCATCTGTTCCTTCTACTTCCTGCACACCTCAGAGTCTTCTGGGTTTATAAAGCAATCTCACATGAGTTGCTGTACCTAACGAGTTTTAGAGGTGTGCCTAGAAGGCAGGCCACGCTGAACAAAAGCTTTCTGAGCTGTAATTGTTAAACAGTGAACCATGGTGTACCTTTCTCGTGGTTTCTGCTTCTAAGACAGAGAACATTTGTACTTCCCTTGTGTCATCTTTTGAATCTTTTCTTTTTAAATTTTAAAATAGGCAAACTGTCAGGTCCATATGGCTTGCCAGCATGGTTTGTACTAGACAGGAAAAAAATCATGCAGTGTATTCTAGCTGAATGGCAAGCCACTCTGGTATTAGATACCCTGGTGTCACAAATTCATCATACTTGGTGGCCTTTCAGAAACTTCTAGTTAGATTCAAACAAAAGAAAGTGAGACTTTAACAAACTTGGACTCTAGGCAAGAAGTTAAGTTTTTATTTTGAGAATAAATTAAATGTAAAGTTTCTGGAAGGCTATATATATATATATATATATATATTTGAGACAGAGTCTCCCTCCGTGGCCCAGGCTGGAGAGCAGTGGCACAATCTCAGCCCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCAGC