Transcript asmbl_123848

Sequence
Transcript Sequence for observation asmbl_123848 of TGE0001989:
ATGAGCAATCCGAGTTCCCGGATGAGGGAACATTCTGCAGTATAAAGGGAGCAGGGAAGGCGGGAGACAGCGCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGATTAGCCTTTTCTCTGCCTTGCTTGCTTGAGCTTCAGCGGAATTCGAAATGGCTGGCGGTAAGGCTGGAAAGGACTCCGGAAAGGCCAAGACAAAGGCGGTTTCCCGCTCGCAGAGAGCCGGCTTGCAGTTCCCAGTGGGCCGTATTCATCGACACCTAAAATCTAGGACGACCAGTCATGGACGTGTGGGCGCGACTGCCGCTGTGTACAGCGCAGCCATCCTGGAGTACCTCACCGCAGAGGTACTTGAACTGGCAGGAAATGCATCAAAAGACTTAAAGGTAAAGCGTATTACCCCTCGTCACTTGCAACTTGCTATTCGTGGAGATGAAGAATTGGATTCTCTCATCAAGGCTACAATTGCTGGTGGTGGTGTCATTCCACACATCCACAAATCTCTGATTGGGAAGAAAGGACAACAGAAGACTGTCTAAAGGATGCCTGGATTCCTTGTTATCTCAGGACTCTAAATACTCTAACAGCTGTCCAGTGTTGGTGATTCCAGTGGACTGTATCTCTGTGAAAAACACAATTTTGCCTTTTTGTAATTCTATTTGAGCAAGTTGGAAGTTTAATTAGCTTTCCAACCAACCAAATTTCTGCATTCGAGTCTTAACCATATTTAAGTGTTACTGTGGCTTCAAAGAAGCTATTGATTCTGAAGTAGTGGGTTTTGATTGAGTTGACTGTTTTTAAAAAACTGTTTGGATTTTAATTGTGATGCAGAAGTTATAGTAACAAACATTTGGTTTTGTACAGACATTATTTCCACTCTGGTGGATAAGTTCAATAAAGGTCATATCCCAAAC