Transcript asmbl_114831

Sequence
Transcript Sequence for observation asmbl_114831 of TGE0056649:
CATGAGGCTCATCCTGCCTGTGGGTTTGATTGCTACCACTCTTGCAATTGCTCCTGTCCGCTTTGACAGGGAGAAGGTGTTCCGCGTGAAGCCCCAGGATGAAAAACAAGCAGACATCATAAAGGACTTGGCCAAAACCAATGAGCTTGACTTCTGGTATCCAGGTGCCACCCACCACGTAGCTGCTAATATGATGGTGGATTTCCGAGTTAGTGAGAAGGAATCCCAAGCCATCCAGTCTGCCTTGGATCAAAATAAAATGCACTATGAAATCTTGATTCATGATCTACAAGAAGAGATTGAGAAACAGTTTGATGTTAAAGAAGATATCCCAGGCAGGCACAGCTACGCAAAATACAATAATTGGGAAAAGATTGTGGCTTGGACTGAAAAGATGATGGATAAGTATCCTGAAATGGTCTCTCGTATTAAAATTGGATCTACTGTTGAAGATAATCCACTATATGTTCTGAAGATTGGGGAAAAGAATGAAAGAAGAAAGGCTATTTTTACGGATTGTGGCATTCACGCACGAGAATGGGTCTCCCCAGCATTCTGCCAGTGGTTTGTCTATCAGGCAACCAAAACTTATGGGAGAAACAAAATTATGACCAAACTCTTGGACCGAATGAATTTTTACATTCTTCCTGTGTTCAATGTTGATGGATATATTTGGTCATGGACAAAGAACCGCATGTGGAGAAAAAATCGTTCCAAGAACCAAAACTCCAAATGCATCGGCACTGACCTCAACAGGAATTTTAATGCTTCATGGAACTCCATTCCTAACACCAATGACCCATGTGCAGATAACTATCGGGGCTCTGCACCAGAGTCCGAGAAAGAGACGAAAGCTGTCACTAATTTCATTAGAAGCCACCTGAATGAAATCAAGGTTTACATCACCTTCCATTCCTACTCCCAGATGCTATTGTTTCCCTATGGATATACATCAAAACTGCCACCTAACCATGAGGACTTGGCCAAAGTTGCAAAGATTGGCACTGATGTTCTATCAACTCGATATGAAACCCGCTACATCTATGGCCCAATAGAATCAACAATTTACCCGATATCAGGTTCTTCTTTAGACTGGGCTTATGACCTGGGCATCAAACACACATTTGCCTTTGAGCTCCGAGATAAAGGCAAATTTGGTTTTCTCCTTCCAGAATCCCGGATAAAGCCAACGTGCAGAGAGACCATGCTAGCTGTCAAATTTATTGCCAAGTATATCCTCAAGCATACTTCCTAAAGAACTGCCCTCTGTTTGGAATAAGCCAATTAATCCTTTTTTGTGCCTTTCATCAGAAAGTCAATCTTCAGTTATCCCCAAATGCAGCTTCTATTTCACCTGAATCCTTCTCTTGCTCATTTAAGTCCCATGTTACTGCTGTTTGCTTTTACTTACTTTCAGTAGCACCATAACGAAGTAGCTTTAAGTGAAACCTTTTAACTACCTTTCTTTGCTCCAAGTGAAGTTTGGACCCAGCAGAAAGCATTATTTTGAAAGGTGATATACAGTGGGGCACAGAAAACAAATGAAAACCTTCAGTTTCTCACAGATTTTCACCATGTGGCTTCATCAATTTATGTGCTAATACAATAAAATAAAATGCACTTAATGCTTTAA