Transcript asmbl_114224

Sequence
Transcript Sequence for observation asmbl_114224 of TGE0058514:
CCCCGCCGTCGGTGCGCGGCGGTAGGGAAGGCGCCTCCCGCAGTCGCTCGGAACTGCCGACCCGAGTGCTTCCCGCAGAGGGCTGGTGGTGGGAGCGGAGTGGGTCGGGCGGGGCCGAGCCGGGCCGTGGGCCGTGTGGGGGCCGGGCGGCGGCCGGGCCGGCGGACGGCGGGATGGGCTGCACCGTGAGCGCCGAGGACAAGGCGGCGGCCGAGCGCTCTAAGATGATCGACAAGAACCTGCGGGAGGACGGAGAGAAGGCGGCGCGGGAGGTGAAGTTGCTGCTGTTGGGTGCTGGGGAGTCAGGGAAGAGCACCATCGTCAAGCAGATGAAGATCATCCACGAGGATGGCTACTCCGAGGAGGAATGCCGGCAGTACCGGGCGGTTGTCTACAGCAACACCATCCAGTCCATCATGGCCATTGTCAAAGCCATGGGCAACCTGCAGATCGACTTTGCCGACCCCTCCAGAGCGGACGACGCCAGGCAGCTATTTGCACTGTCCTGCACCGCCGAGGAGCAAGGCGTGCTCCCTGATGACCTGTCCGGCGTCATCCGGAGGCTCTGGGCTGACCATGGTGTGCAGGCCTGCTTTGGCCGCTCAAGGGAATACCAGCTCAACGACTCAGCTGCCTACTACCTGAACGACCTGGAGCGTATTGCACAGAGTGACTACATCCCCACACAGCAAGATGTGCTACGGACCCGCGTAAAGACCACGGGGATCGTGGAGACACACTTCACCTTCAAGGACCTACACTTCAAGATGTTTGATGTGGGTGGTCAGCGGTCTGAGCGGAAGAAGTGGATCCACTGCTTTGAGGGCGTCACAGCCATCATCTTCTGCGTAGCCTTGAGCGCCTATGACTTGGTGCTAGCTGAGGACGAGGAGATGAACCGCATGCATGAGAGCATGAAGCTATTCGATAGCATCTGCAACAACAAGTGGTTCACAGACACGTCCATCATCCTCTTCCTCAACAAGAAGGACCTGTTTGAGGAGAAGATCACACACAGTCCCCTGACCATCTGCTTCCCTGAGTACACAGGGGCCAACAAATATGATGAGGCAGCCAGCTACATCCAGAGTAAGTTTGAGGACCTGAATAAGCGCAAAGACACCAAGGAGATCTACACGCACTTCACGTGCGCCACCGACACCAAGAACGTGCAGTTCGTGTTTGACGCCGTCACCGATGTCATCATCAAGAACAACCTGAAGGACTGCGGCCTCTTCTGAGGGGCAGCGGGGCCTGGCGGGATGGTGAGCCAGAGGGGCTGTGGCAGGGTGCTGGGGAAGAACTAAGCGGGCCTGGAGCC