Transcript asmbl_112613

Sequence
Transcript Sequence for observation asmbl_112613 of TGE0056876:
TTCCCAACTTTGCTCAAAGTCGCTGGACTCTAAGCTGTCGGAGGGACCGCTGGACAGACCTGGGAACTGACAGAGGGCCTGGAGGGAAACAGGCCAAAGACCCACAGGCAGAGTTGACACGGAACCCCAAAGCAAGGAGGAGGGCTCGGGCCCGAGACCGTTCACCTCCCCTTATCCCTGTTCCCCTCTTCAGGATGGAGCTGACCTCAAGGGAAAGAGGGAGGGGACAGCCTCTGCCCTGGGAACTTCGACTGGGCCTACTGCTAAGCGTGCTGGCTGCCACACTGGCACAGGCCCCTGCCCCGGATGTGCCTGGCTGTTCCAGGGGAAGCTGCTACCCCGCCACGGGCGACCTGCTGGTGGGCCGAGCTGACAGACTGACTGCCTCATCCACTTGTGGCCTGAATGGCCCCCAGCCCTACTGCATCGTCAGTCACCTGCAGGACGAAAAGAAGTGCTTCCTTTGTGACTCCCGGCGCCCCTTCTCTGCTAGAGACAACCCACACAGCCATCGCATCCAGAATGTAGTCACCAGCTTTGCACCACAGCGGCGGGCAGCCTGGTGGCAGTCAGAGAATGGTATCCCTGCGGTCACCATCCAGCTGGACCTGGAGGCTGAGTTTCATTTCACACACCTCATTATGACCTTCAAGACATTTCGCCCTGCTGCCATGCTGGTGGAACGCTCAGCAGACTTTGGCCGCACCTGGCATGTGTACCGATATTTCTCCTATGACTGTGGGGCTGACTTCCCAGGAGTCCCACTAGCACCCCCACGGCACTGGGATGATGTAGTCTGTGAGTCCCGCTACTCAGAGATTGAGCCATCCACTGAAGGCGAGGTCATCTATCGTGTGCTGGACCCTGCCATCCCTATCCCAGACCCCTACAGCTCACGGATTCAGAACCTGTTGAAGATCACCAACCTACGGGTGAACCTGACTCGTCTACACACGTTGGGAGACAACCTACTCGACCCACGGAGGGAGATCCGAGAGAAGTACTACTATGCCCTCTATGAGCTGGTTGTACGTGGCAACTGCTTCTGCTACGGACACGCCTCAGAGTGTGCACCCGCCCCAGGGGCACCAGCCCATGCTGAGGGCATGGTGCACGGAGCTTGCATCTGCAAACACAACACACGTGGCCTCAACTGCGAGCAGTGTCAGGATTTCTATCGTGACCTGCCCTGGCGTCCGGCTGAGGACGGCCATAGTCATGCCTGTAGGAAGTGTGAGTGCCATGGGCACACCCACAGCTGCCACTTCGACATGGCCGTATACCTGGCATCTGGCAATGTGAGTGGAGGTGTGTGTGATGGATGTCAGCATAACACAGCTGGGCGCCACTGTGAGCTCTGTCGGCCCTTCTTCTACCGTGACCCAACCAAGGACCTGCGGGATCCGGCTGTGTGCCGCTCCTGTGATTGTGACCCCATGGGTTCTCAAGACGGTGGTCGCTGTGATTCCCATGATGACCCTGCACTGGGACTGGTCTCCGGCCAGTGTCGCTGCAAAGAACATGTGGTGGGCACTCGCTGCCAGCAATGCCGTGATGGCTTCTTTGGGCTCAGCATCAGTGACCGTCTGGGCTGCCGGCGATGTCAATGTAATGCACGGGGCACAGTGCCTGGGAGCACTCCTTGTGACCCCAACAGTGGATCCTGTTACTGCAAACGTCTAGTGACTGGACGTGGATGTGACCGCTGCCTGCCTGGCCACTGGGGCCTGAGCCACGACCTGCTCGGCTGCCGCCCCTGTGACTGCGACGTGGGTGGTGCTTTGGATCCCCAGTGTGATGAGGGCACAGGTCAATGCCACTGCCGCCAGCACATGGTTGGGCGACGCTGTGAGCAGGTGCAACCTGGCTACTTCCGGCCCTTCCTGGACCACCTAATTTGGGAGGCTGAGGACACCCGAGGGCAGGTGCTCGATGTGGTGGAGCGCCTGGTGACCCCCGGGGAAACTCCATCCTGGACTGGCTCAGGCTTCGTGCGGCTACAGGAAGGTCAGACCCTGGAGTTCCTGGTGGCCTCTGTGCCGAAGGCTATGGACTATGACCTGCTGCTGCGCTTAGAGCCCCAGGTCCCTGAGCAATGGGCAGAGTTGGAACTGATTGTGCAGCGTCCAGGGCCTGTGCCTGCCCACAGCCTGTGTGGGCATTTGGTGCCCAAGGATGATCGCATCCAAGGGACTCTGCAACCACATGCCAGGTACTTGATATTTCCTAATCCTGTCTGCCTTGAGCCTGGTATCTCCTACAAGCTGCATCTGAAGCTGGTACGGACAGGGGGAAGTGCCCAGCCTGAGACTCCCTACTCTGGACCTGGCCTGCTCATTGACTCGCTGGTGCTGCTGCCCCGTGTCCTGGTGCTAGAGATGTTTAGTGGGGGTGATGCTGCTGCCCTGGAGCGCCAGGCCACCTTTGAACGCTACCAATGCCATGAGGAGGGTCTGGTGCCCAGCAAGACTTCTCCCTCTGAGGCCTGCGCACCCCTCCTCATCAGCCTGTCCACCCTCATCTACAATGGTGCCCTGCCATGTCAGTGCAACCCTCAAGGTTCACTGAGTTCTGAGTGCAACCCTCATGGTGGTCAGTGCCTGTGCAAGCCTGGAGTGGTTGGGCGCCGCTGTGACCTCTGTGCCCCTGGCTACTATGGCTTTGGCCCCACAGGCTGTCAAGCCTGCCAGTGCAGCCACGAGGGGGCACTCAGCAGTCTCTGTGAAAAGACCAGTGGGCAATGTCTCTGTCGAACTGGTGCCTTTGGGCTTCGCTGTGACCGCTGCCAGCGTGGCCAGTGGGGATTCCCTAGCTGCCGGCCATGTGTCTGCAATGGGCATGCAGATGAGTGCAACACCCACACAGGCGCTTGCCTGGGCTGCCGTGATCACACAGGGGGTGAGCACTGTGAAAGGTGCATTGCTGGTTTCCACGGGGACCCACGGCTGCCATATGGGGGCCAGTGCCGGCCCTGTCCCTGTCCTGAAGGCCCTGGGAGCCAACGGCACTTTGCTACTTCTTGCCACCAGGATGAATATTCCCAGCAGATTGTGTGCCACTGCCGGGCAGGCTATACGGGGCTGCGATGTGAAGCTTGTGCCCCTGGGCACTTTGGGGACCCATCAAGGCCAGGTGGCCGGTGCCAACTGTGTGAGTGCAGTGGGAACATTGACCCAATGGATCCTGATGCCTGTGACCCCCACACGGGGCAATGCCTGCGCTGTTTACACCACACAGAGGGTCCACACTGTGCCCACTGCAAGCCTGGCTTCCATGGGCAGGCTGCCCGACAGAGCTGTCACCGCTGCACATGCAACCTGCTGGGCACAAATCCGCAGCAGTGCCCATCTCCTGACCAGTGCCACTGTGATCCAAGCAGTGGGCAGTGCCCATGCCTCCCCAATGTCCAGGGCCCTAGCTGTGACCGCTGTGCCCCCAACTTCTGGAACCTCACCAGTGGCCATGGTTGCCAGCCTTGTGCCTGCCACCCAAGCCGGGCCAGAGGCCCCACCTGCAACGAGTTCACAGGGCAGTGCCACTGCCGTGCCGGCTTTGGAGGGCGGACTTGTTCTGAGTGCCAAGAGCTCCACTGGGGAGACCCTGGGTTGCAGTGCCATGCCTGTGATTGTGACTCTCGTGGAATAGATACACCTCAGTGTCACCGCTTCACAGGTCACTGCAGCTGCCGCCCAGGGGTGTCTGGTGTGCGCTGTGACCAGTGTGCCCGTGGCTTCTCAGGAATCTTTCCTGCCTGCCATCCCTGCCATGCATGCTTCGGGGATTGGGACCGAGTGGTGCAGGACTTGGCAGCCCGTACACAGCGCCTAGAGCAGCGGGCGCAGGAGTTGCAACAGACGGGTGTGCTGGGTGCCTTTGAGAGCAGCTTCTGGCACATGCAGGAGAAGCTGGGCATTGTGCAGGGCATCGTAGGTGCCCGCAACACCTCAGCCGCCTCCACTGCACAGCTTGTGGAGGCCACAGAGGAGCTGCGGCGTGAAATTGGGGAGGCCACTGAGCACCTGACTCAGCTCGAGGCAGACCTGACAGATGTGCAAGATGAGAACTTCAATGCCAACCATGCACTAAGTGGTCTGGAGCGAGATAGGCTTGCACTTAATCTCACACTGCGGCAGCTCGACCAGCATCTTGACTTGCTCAAACATTCAAACTTCCTGGGTGCCTATGACAGCATCCGGCATGCCCATAGCCAGTCTGCAGAGGCAGAACGTCGTGCCAATACCTCAGCCCTGGCAGTACCTAGCCCTGTGAGCAACTCGGCAAGTGCTCGGCATCGGACAGAGGCACTGATGGATGCTCAGAAGGAGGACTTCAACAGCAAACACATGGCCAACCAGCGGGCACTTGGCAAGCTCTCTGCCCATACCCACACCCTGAGCCTGACAGACATAAATGAGCTGGTGTGTGGGGCACCAGGGGATGCACCCTGTGCTACAAGCCCTTGTGGGGGTGCCGGCTGTCGAGATGAGGATGGGCAGCCGCGCTGTGGGGGCCTCAGCTGCAATGGGGCAGCGGCTACAGCAGACCTAGCACTGGGCCGGGCCCGGCACACACAGGCAGAGCTGCAGCGGGCACTGGCAGAAGGTGGTAGCATCCTCAGCAGAGTGGCTGAGACTCGTCGGCAGGCAAGCGAGGCACAGCAGCGGGCCCAGGCAGCCCTGGACAAGGCTAATGCTTCCAGGGGACAGGTGGAACAGGCCAACCAGGAACTTCAAGAACTTATCCAGAGTGTGAAGGACTTCCTCAACCGTGAGCCTCCCACGTGTCCCAGGCCATGTGGTTGTCCCCTTTGGCAACTCCCGGTGTCTGTATCTCCCTTGGTTCATACTTGAGCCTCAGGGACTACACTGGATTAGTGTTTATGATCCCTTGACTGGCTCCTGAGTTATTGCCCATATGTGGTCCCAGGTCCATGTTCTTGAGTCTGAGCCCCTTGTATAGTCCCTGTCCTTGTGATTATATCCTTATGCCTGGTAACAAACCCCTATCCCATGTACATGTCCTGAGTCCATACCCCAAAACTGTATCCTCATGCCCATGCTGGAGAATCTATGTTCTTAAGTTCTTGCTGTGTCCCTATAGAGGAGGGGGCTGATCCTGATAGCATTGAAATGGTGGCCACACGGGTGCTAGAGCTCTCCATCCCAGCTTCAGCTGAGCAGATCCAGCACCTGGCGGGTGCGATTGCAGAGCGAGTCCGGAGCCTGGCAGATGTGGATGCGATCCTGGCACGTACTGTAGGAGATGTGCGTCGTGCCGAGCAGCTACTGCAGGATGCACGGCGGGCAAGGAGCTGGGCTGAGGATGAGAAACAGAAGGCAGAGACAGTACAGGCAGCACTGGAGGAGGCCCAGCGGGCACAGGGTATTGCCCAGGGTGCCATCCGGGGGGCAGTGGCTGACACACGGGACACAGAGCAGACCCTGTACCAGGTACAGGAGAGGATGGCAGGTGCAGAGCGGGCACTGAGCTCTGCAGGTGAAAGGGCTCGGCAGTTGGATGCTCTCCTGGAGGCTCTGAAATTGAAACGGGCAGGAAATAGTCTGGCAGCCTCTACAGCAGAAGAAACGGCAGGCAGTGCCCAGGGTCGTGCCCAGGAGGCTGAGCAGCTGCTACGCGGTCCTCTGGGTGATCAGTACCAGACGGTGAAGGCCCTAGCTGAGCGCAAGGCCCAAGGTGTGCTGGCTGCACAGGCAAGGGCAGAACAACTGCGGGATGAGGCTCGGGACCTGTTGCAAGCCGCTCAGGACAAGCTGCAGCGGCTACAGGGTAAGAAATGGGGCACCAGAGACACAAGACTGCGGGAAACCCCCCCTAAACTGACACCTGCCCTTCCTAGAATTGGAAGGCACCTATGAGGA