Transcript asmbl_111743

Sequence
Transcript Sequence for observation asmbl_111743 of TGE0001673:
GTTGATTGGGACCGAGTACAGGGCCCGCGCATGCGTGGATTGTCGTCTTCTGTCCAAGTTGGTCGCTTCCCTGCGCCAAAGTGAGCAGTAGCCAACATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGGAAGAACAAGAAGAGAACCTTGAAGCAAGTGGAGACTATAAATATTCAGGAAGAGATAGTTTGATTTTTTTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAAGATGAGTTGACACCTTTTGACATGAGCATCCAGTGTATCCAAAGTGTGTACATCAGTAAGATCATAAGCAGTGATCGAGATCTCTTGGCTGTGGTGTTCTATGGTACCGAGAAAGACAAAAATTCAGTGAATTTTAAAAATATTTACGTCTTACAGGAGCTGGATAATCCAGGTGCAAAACGAATTCTAGAGCTTGACCAGTTTAAGGGGCAGCAGGGACAAAAACGTTTCCAAGACATGATGGGCCACGGATCTGACTACTCACTCAGTGAAGTGCTGTGGGTCTGTGCCAACCTCTTTAGTGATGTCCAATTCAAGATGAGTCATAAGAGGATCATGCTGTTCACCAATGAAGACAACCCCCATGGCAATGACAGTGCCAAAGCCAGCCGGGCCAGGACCAAAGCCGGTGATCTCCGAGATACAGGCATCTTCCTTGACTTGATGCACCTGAAGAAACCTGGGGGCTTTGACATATCCTTGTTCTACAGAGATATCATCAGCATAGCAGAGGATGAGGACCTCAGGGTTCACTTTGAGGAATCCAGCAAGCTAGAAGACCTGTTGCGGAAGGTTCGCGCCAAGGAGACCAGGAAGCGAGCACTCAGCAGGTTAAAGCTGAAGCTCAACAAAGATATAGTGATCTCTGTGGGCATTTATAATCTGGTCCAGAAGGCTCTCAAGCCTCCTCCAATAAAGCTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACCCGGACCTTTAATACAAGTACAGGCGGTTTGCTTCTGCCTAGCGATACCAAGAGGTCTCAGATCTATGGGAGTCGTCAGATTATACTGGAGAAAGAGGAAACAGAAGAGCTAAAACGGTTTGATGATCCAGGTTTGATGCTCATGGGTTTCAAGCCGTTGGTACTGCTGAAGAAACACCATTACCTGAGGCCCTCCCTGTTCGTGTACCCAGAGGAGTCGCTGGTGATTGGGAGCTCAACCCTGTTCAGTGCTCTGCTCATCAAGTGTCTGGAGAAGGAGGTTGCAGCATTGTGCAGATACACACCCCGCAGGAACATCCCTCCTTATTTTGTGGCTTTGGTGCCACAGGAAGAAGAGTTGGATGACCAGAAAATTCAGGTGACTCCTCCAGGCTTCCAGCTGGTCTTTTTACCCTTTGCTGATGATAAAAGGAAGATGCCCTTTACTGAAAAAATCATGGCAACTCCAGAGCAGGTGGGCAAGATGAAGGCTATCGTTGAGAAGCTTCGCTTCACATACAGAAGTGACAGCTTTGAGAACCCCGTGCTGCAGCAGCACTTCAGGAACCTGGAGGCCTTGGCCTTGGATTTGATGGAGCCGGAACAAGCAGTGGACCTGACATTGCCCAAGGTTGAAGCAATGAATAAAAGACTGGGCTCCTTGGTGGATGAGTTTAAGGAGCTTGTTTACCCACCAGATTACAATCCTGAAGGGAAAGTTACCAAGAGAAAACACGATAATGAAGGTTCTGGAAGCAAAAGGCCCAAGGTGGAGTATTCAGAAGAGGAGCTGAAGACCCACATCAGCAAGGGTACGCTGGGCAAGTTCACTGTGCCCATGCTGAAAGAGGCCTGCCGGGCTTACGGGCTGAAGAGTGGGCTGAAGAAGCAGGAGCTGCTGGAAGCCCTCACCAAGCACTTCCAGGACTGACCAGAGGCCGCGCGTCCAGCTGCCCTTCCGCAGTGTGGCCAGGCTGCCTGGCCTTGTCCTCAGCCAGTTAAAATGTGTTTCTCCTGAGCTAGGAAGAGTCTACCCGACATAAGTCGAGGGACTTTATGTTTTTGAGGCTTTCTGTTGCCATGGTGATGGTGTAGCCCTCCCACTTTGCTGTTCCTTACTTTACTGCCTGAATAAAGAGCCCTAAGTTTGTACTATATACTGTTCTTTTGTGTGAAGGAGAAAGGTGTGTATGCCTTGCATCCAAAACTTGCTAGCCATCACTTAGCTTAATTTTCTCTTTCATTGGGAACACTCATCACCACAATGGAAAC