Transcript asmbl_111637

Sequence
Transcript Sequence for observation asmbl_111637 of TGE0001666:
CACCCGGTCCGGTCCAGTTAAAAGGGTGGGAGCGTCCGGGGGCCCATCTCTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACTCAATCATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGAAATCAGCCAGCCCATGGCCCCCAATAAAGGCAGCTGCCTCTGCTCCCTCTGAACCAGCCTCGTGTGTGTGCTTGTGCGTGTGTGTGTATGTGTGTG