Transcript asmbl_106208

Sequence
Transcript Sequence for observation asmbl_106208 of TGE0001566:
GCGTGCTCCTCGCTTCCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCATGGCGCTTCACGTTCCCAAGGCTCCGGGCTTTGCCCAGATGCTCAAGGAGGGAGCGAAACACTTTTCAGGATTAGAAGAGGCTGTGTATAGAAACATACAAGCTTGCAAGGAGCTTGCCCAAACCACTCGTACAGCATATGGACCAAATGGAATGAACAAAATGGTTATCAACCACTTGGAGAAGTTGTTTGTGACAAACGATGCAGCAACTATTTTAAGAGAACTAGAAGTACAGCATCCTGCTGCAAAAATGATTGTAATGGCTTCTCATATGCAAGAGCAAGAAGTTGGAGATGGCACAAACTTTGTTCTGGTATTTGCTGGAGCTCTCCTGGAATTAGCTGAAGAACTTCTGAGGATTGGCCTGTCAGTTTCAGAGGTCATAGAAGGTTATGAAATAGCCTGCAGAAAAGCTCATGAGATTCTTCCTAATTTGGTATGTTGTTCTGCAAAAAACCTTCGAGATATTGATGAAGTCTCATCTCTACTTCGTACCTCCATAATGAGTAAACAATATGGTAATGAAGTATTTCTGGCCAAGCTTATTGCTCAGGCATGCGTATCTATTTTTCCTGATTCCGGCCATTTCAATGTTGATAACATCAGAGTTTGTAAAATTCTGGGCTCTGGTATCAGTTCCTCTTCAGTATTGCATGGCATGGTTTTTAAGAAGGAAACCGAAGGTGATGTAACATCTGTCAAAGATGCAAAAATAGCAGTGTACTCTTGTCCTTTTGATGGCATGATAACAGAAACTAAGGGAACAGTGTTGATAAAGACTGCTGAAGAATTGATGAATTTTAGTAAGGGAGAAGAAAACCTCATGGATGCACAAGTCAAAGCTATTGCTGATACTGGTGCAAATGTCGTAGTAACAGGTGGCAAAGTGGCAGACATGGCTCTTCATTATGCAAATAAATATAATATCATGTTAGTGAGGCTAAACTCAAAATGGGATCTCCGAAGACTTTGTAAAACTGTTGGTGCTACAGCTCTTCCTAGATTGACACCTCCTGTCCTTGAAGAAATGGGACACTGTGACAGTGTTTACCTCTCAGAAGTTGGAGATACTCAGGTGGTGGTTTTTAAGCATGAAAAGGAAGATGGCGCCATTTCTACCATAGTACTTCGAGGCTCTACAGACAATCTGATGGATGACATAGAAAGGGCAGTAGACGATGGTGTTAATACTTTCAAAGTTCTTACAAGGGATAAACGTCTTGTACCCGGAGGTGGAGCAACAGAAATTGAATTAGCCAAACAGATCACATCATATGGAGAGACATGTCCTGGACTTGAACAGTATGCTATTAAGAAGTTTGCTGAGGCATTTGAAGCTATTCCCCGCGCACTGGCAGAAAACTCTGGAGTTAAGGCCAATGAAGTAATCTCTAAACTTTATGCAGTACATCAAGAAGGAAATAAAAACGTTGGATTAGATATTGAGGCTGAAGTCCCTGCTGTAAAGGACATGCTGGAAGCTGGTATTCTAGATACTTACCTGGGAAAATATTGGGCTATCAAACTCGCTACTAATGCTGCAGTCACTGTACTTAGAGTGGATCAGATCATCATGGCAAAACCAGCTGGTGGGCCCAAGCCTCCAAGTGGGAAGAAAGACTGGGATGATGACCAAAATGATTGAAATTGGCTTAATTTTTACTGTAGGTGAAGGCTGTATTTGTAGTAGTACTCAAGAATCACCTGATGTTTTCTTATTCTCCTTAAATTAAGAGTTATTTTGTGTTTGTATTCTTGGCTGGATGTTATAATAAACATATTGTTACTGTCAAA